View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_45 (Length: 259)
Name: NF2329_low_45
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_45 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 259
Target Start/End: Original strand, 32812558 - 32812809
Alignment:
| Q |
18 |
gtaatctagagcgctctgtaattctatctatcacataatagaaaaccacatcagtcgcttaagtgtcagagatataagtacaattggctgaattctgtga |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32812558 |
gtaagctagagcgctctgtaattctatctatcacataatagaaaaccacatcagtcgcttaagcgtcagagatataagtacaattggctgaattttgtga |
32812657 |
T |
|
| Q |
118 |
tcgattgtttattt----------attttcaaactggatttgctattctaacactcacattgcctaatagatcctttgattatcatgtttaattaagaag |
207 |
Q |
| |
|
||||| ||| ||| ||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32812658 |
tcgatcgttgttttcttttttattattttaaaactggatttgctattctaacacacacaatgcctaatagatcctttgattatcatttttaattaagaag |
32812757 |
T |
|
| Q |
208 |
taggagtaatttattgccacaaacttcaaacacaactatttgcaaaacatgt |
259 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32812758 |
tagtagtaatttattgccacaaacttcaaacacaactatttgcaaaacatgt |
32812809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University