View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_52 (Length: 248)
Name: NF2329_low_52
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 279775 - 279528
Alignment:
| Q |
1 |
caagagagcgtgtatattacttttttgattataatttccacgtaatgcttatacaaagaatcaagaaaccaactcaatttg--atctcattatttagaag |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
279775 |
caagagagcgtgtatattacttttttgattataatttccacgtaatgcttatacaaagaatcaagaaaccaactcaatttgatatctcattatttagaag |
279676 |
T |
|
| Q |
99 |
taaaggtttgctttgtaatcaatttcatatatgctaagaattaaatagaaaacagcnnnnnnnntcagaaaaatggaatggaactcgggtctcttaaagt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
279675 |
taaaggtttgctttgtaatcaatttcatatatgctaagaattaaatagaaaacagcaaaaaaaatcacaaaaatggaatggaactcgggtctcttaaagt |
279576 |
T |
|
| Q |
199 |
gctgcattctcttttattggtatgttgttatgcatatcctttgctact |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
279575 |
gctgcattctcttttattggtatgttgttatgcatatcctttgttact |
279528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University