View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_55 (Length: 239)
Name: NF2329_low_55
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 41389467 - 41389584
Alignment:
| Q |
107 |
aaaaatggactatgtataatgtagtagtactataaaactttcatcatgatgaggtcccttgtctaacaccccacctattactaatgatgatatgaattaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41389467 |
aaaaatggactatgtataatgtagtagtactataaaactttcatcatgatgaggtcccttgtctaacaccccacctattactaatgatgatatgaattaa |
41389566 |
T |
 |
| Q |
207 |
-ttttttatagaaaaaat |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41389567 |
tttttttatagaaaaaat |
41389584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 41389360 - 41389407
Alignment:
| Q |
1 |
tgtacgttaaacaggttttctaaatttgatatttgatgcacaaatatg |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41389360 |
tgtacgttaaacaggttttctaaatttgatatttgatgcacaaatatg |
41389407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University