View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_60 (Length: 238)
Name: NF2329_low_60
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_60 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 37844651 - 37844874
Alignment:
| Q |
18 |
gttcttccactggtggtaccgtagcaaaggatgccgttggcaatgatgtggttgcagcagaatggctaaagtcacatggacccggtgaccgtactcttac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37844651 |
gttcttccactggtggtaccgtagcaaaggatgccgttggcaatgatgtggttgcagcagaatggctaaagtcacatggacccggtgaccgtactcttac |
37844750 |
T |
|
| Q |
118 |
acaaggattaaaggtaagtgttcaattgcaaactggttagtgtgtctcc---ataagtcgttttcattagctattctagagagcttatgaaaatgactta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37844751 |
acaaggattaaaggtaagtgttcaattgcaaactggttagtgtgtctccattataagtcgttttcattagctattctagagagcttatgaaaatgactta |
37844850 |
T |
|
| Q |
215 |
tagataaacacttatatgataagc |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37844851 |
tagataaacacttatatgataagc |
37844874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 208
Target Start/End: Original strand, 10923604 - 10923638
Alignment:
| Q |
174 |
gttttcattagctattctagagagcttatgaaaat |
208 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
10923604 |
gttttcattagctattctggagagcttatgaaaat |
10923638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 208
Target Start/End: Complemental strand, 26473820 - 26473780
Alignment:
| Q |
168 |
taagtcgttttcattagctattctagagagcttatgaaaat |
208 |
Q |
| |
|
||||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
26473820 |
taagttgttttcataagctatcctagagagcttatgaaaat |
26473780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 25479582 - 25479623
Alignment:
| Q |
167 |
ataagtcgttttcattagctattctagagagcttatgaaaat |
208 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
25479582 |
ataagttgttttcataagctatcctagagagcttatgaaaat |
25479623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University