View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_70 (Length: 219)
Name: NF2329_low_70
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_70 |
 | |
|
| [»] scaffold0455 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 201
Target Start/End: Complemental strand, 41420069 - 41419882
Alignment:
| Q |
14 |
cacagacacaatacttgatggcgaaaatgttgtctgatgacgagttcgttgaaaagtttcttactgaaagtgcaaagaggttagcacaaaggtacataat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41420069 |
cacagacacaatacttgatggcgaaaatgctgtctgatgacgagttcgttaaaaagtttcttactgaaagtgcaaagaggttagcacaaaggtacagaat |
41419970 |
T |
|
| Q |
114 |
tttcactagtggattaaccaaagttggaattaattgtttacaaagtaacggtggactttttgtgtggatggatctgagaggacttctt |
201 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41419969 |
tttcaccagtggattaaccaaagttggaattaattgtttacaaagtaacggtggactttttgtgtggatggatttgagaggacttctt |
41419882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0455 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: scaffold0455
Description:
Target: scaffold0455; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 49 - 201
Target Start/End: Complemental strand, 8518 - 8366
Alignment:
| Q |
49 |
gatgacgagttcgttgaaaagtttcttactgaaagtgcaaagaggttagcacaaaggtacataattttcactagtggattaaccaaagttggaattaatt |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8518 |
gatgacgagttcgttgaaaagtttcttactgaaagtgcaaagaggttagcacaaaggtacaaaattttcactagtggattaaccaaagttggaattaatt |
8419 |
T |
|
| Q |
149 |
gtttacaaagtaacggtggactttttgtgtggatggatctgagaggacttctt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8418 |
gtttacaaagtaacggtggactttttgtgtggatggatctgagaggacttctt |
8366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 49 - 201
Target Start/End: Complemental strand, 28129931 - 28129779
Alignment:
| Q |
49 |
gatgacgagttcgttgaaaagtttcttactgaaagtgcaaagaggttagcacaaaggtacataattttcactagtggattaaccaaagttggaattaatt |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28129931 |
gatgacgagttcgttgaaaagtttcttactgaaagtgcaaagaggttagcacaaaggtacaaaattttcactagtggattaaccaaagttggaattaatt |
28129832 |
T |
|
| Q |
149 |
gtttacaaagtaacggtggactttttgtgtggatggatctgagaggacttctt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28129831 |
gtttacaaagtaacggtggactttttgtgtggatggatctgagaggacttctt |
28129779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University