View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2330_high_5 (Length: 341)
Name: NF2330_high_5
Description: NF2330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2330_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 8 - 328
Target Start/End: Original strand, 45310082 - 45310403
Alignment:
| Q |
8 |
aagcaaaggggacagagatttcgcatcactaatcctcagtttatttggagctaagtatatagctaattataagactatattcattgacattggatgagat |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45310082 |
aagcgaaggggacagagatttcgcatcactaatcctcagtttatttggagctaagtatatagctaattataagactatgttcattgacattggatgagat |
45310181 |
T |
|
| Q |
108 |
ttttatgaaggataggattatttgtaaatgtcttaacatacaatattagtaactgaggatagaaaaagaactctattgtatttgtatgtatatcctggtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45310182 |
ttttatgaaggataggattatttgtaaatgtcttaatatacaatattagtaactgaggatagaaaaagaactctattgtatttgtatgtatatcctggtt |
45310281 |
T |
|
| Q |
208 |
ttttcttgggattgaatacatcgtatcctctcatgcaggagatggaatagctttttt-cttcttgtatgattgttagaaattgaattcagtagctttgcc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45310282 |
ttttcttgggattgaatacatcgtatcctctcatgcaggagatggaataacttttttccttcttgtatgattgttagaaattgaattcagtagctttgcc |
45310381 |
T |
|
| Q |
307 |
catgggaggagcagtcatgact |
328 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
45310382 |
catgggaggtgcagtcatgact |
45310403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University