View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2330_high_8 (Length: 276)
Name: NF2330_high_8
Description: NF2330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2330_high_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 14 - 180
Target Start/End: Complemental strand, 26313182 - 26313016
Alignment:
| Q |
14 |
atattcattataaatcacactttgtttcaaacatttagttggaacaagagtgattggagcacaactacgtagaactttgccctaggttgcgcgactacgt |
113 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
26313182 |
atattcattataaatcacactttatttcaaacatttagttggaacaagagtggttggagcacaactacgcgtaactttgccctaggatgcgcgactacgt |
26313083 |
T |
|
| Q |
114 |
taaacttcgacggaggccaaaatgtcttagccttgatttgaggttcggtcgtatggttgatctaaga |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26313082 |
taaacttcgacggaggccaaaatgtcttagccttgatttgaggttcggtcgtatggtcgatctaaga |
26313016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 180 - 258
Target Start/End: Complemental strand, 26312917 - 26312839
Alignment:
| Q |
180 |
atgtatttcttgatctcttcctatcccattgttgataaatatgttttgctacttcaaagaacattaatcatgcttttat |
258 |
Q |
| |
|
||||| |||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26312917 |
atgtaattcttgatctcttcctattccattattgataaatattttttgctacttcaaagaacattaatcatgcttttat |
26312839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University