View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2330_low_15 (Length: 226)
Name: NF2330_low_15
Description: NF2330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2330_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 25014911 - 25014722
Alignment:
| Q |
19 |
tgtttgtcctttgactaagtgctgatcttgtgagtgtttgttcctcgatgccgttgattattgaatcaatctgattgtttacttttgtgtgtcatctgtt |
118 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||| | |||| |
|
|
| T |
25014911 |
tgtttgtcctttgactaagtgttgatcttgtgagtgtttgtccctcgatgccgttgattattgaatcaatctgatcgtttacttttgtatgtcctatgtt |
25014812 |
T |
|
| Q |
119 |
cttctatttcttgttccgattgattgtgttgtgtccctttccttttctgatcagatttgcgagatccctgctttccttttgcgagttcat |
208 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25014811 |
cttttatttcttgttccgattgattgtgttgtgtccctttccttttctgatcggatttgcgagatccctgctttccttttgcgagttcat |
25014722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 22 - 98
Target Start/End: Complemental strand, 19116207 - 19116131
Alignment:
| Q |
22 |
ttgtcctttgactaagtgctgatcttgtgagtgtttgttcctcgatgccgttgattattgaatcaatctgattgttt |
98 |
Q |
| |
|
||||||||||||||| | ||| |||||||||| |||||||||||||| ||||||| ||||||||||||||| |||| |
|
|
| T |
19116207 |
ttgtcctttgactaaacgttgaccttgtgagtgcttgttcctcgatgcggttgattgttgaatcaatctgatcgttt |
19116131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University