View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2331R-Insertion-2 (Length: 83)
Name: NF2331R-Insertion-2
Description: NF2331R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2331R-Insertion-2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 8e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 8e-33
Query Start/End: Original strand, 7 - 81
Target Start/End: Original strand, 29526055 - 29526129
Alignment:
| Q |
7 |
catacactactttttaagatgagctcaaaattttagttgtccaaaaatgaaactttgtgagatgtcactttccaa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29526055 |
catacactactttttaagatgagctcaaaattttagttgtccaaaaatgaaactttgtgagacgtcactttccaa |
29526129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University