View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2331_high_6 (Length: 242)
Name: NF2331_high_6
Description: NF2331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2331_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 117 - 187
Target Start/End: Complemental strand, 5312843 - 5312773
Alignment:
| Q |
117 |
cagactacacaactattcaagtaaactcaccatgtaatgtctaatatccataattcagagaatgcatattc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5312843 |
cagactacacaactattcaagtaaactcaccatgtaatgtctaatatccatatatcagagaatgcatattc |
5312773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 8 - 82
Target Start/End: Complemental strand, 5312923 - 5312849
Alignment:
| Q |
8 |
aaaccacattcatccctttgtacttagagttacaatggttcaactcatccttccgtgatgagttgtaatgtttca |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||| ||||| ||| | || ||||| ||||| |
|
|
| T |
5312923 |
aaaccacattcatccctttgtacttagagttgcaatggtccaactcattcttccatgaagcgtcgtaatctttca |
5312849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University