View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2331_low_3 (Length: 344)
Name: NF2331_low_3
Description: NF2331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2331_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 18 - 332
Target Start/End: Complemental strand, 55667575 - 55667261
Alignment:
| Q |
18 |
cgtaattcatggcaaacagaaacaggtgactaacaaacaaaagggcagtatgcaattgggatattattcttgtaattggtgtagagattgactagaaact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55667575 |
cgtaattcatggcaaacagaaacaggtgactaacaaacaaaagggcagtatgcaattgggatattattcttgtaattggtgtagagattgactagaaact |
55667476 |
T |
 |
| Q |
118 |
attgtgcatgtttttagtgactgccccttggcgttggaattttggatgcatgtagttcctctagatccttacaacagattctttaacttgaatttgtatc |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55667475 |
attgtgcatgtttttagtgactgctccttggcgttggaattttggatttatgtagttcctctagatccttacaacagattctttaacttgaatttgtatc |
55667376 |
T |
 |
| Q |
218 |
aatgactcgatcttaacattgtctgcaattttggttgcgcttgcgcactactaattattcattggtcgtgatttcataataaattcatcctcatacgcat |
317 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
55667375 |
aatggctcgatcttaacattgtctgcaattttggttgcgcttgcgcactactaattattcattgatcgtgatttcatactgaattcatcctcatacgcat |
55667276 |
T |
 |
| Q |
318 |
ttatcttcatacgct |
332 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
55667275 |
tcatcttcatacgct |
55667261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University