View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2331_low_7 (Length: 222)
Name: NF2331_low_7
Description: NF2331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2331_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 104 - 207
Target Start/End: Complemental strand, 31920864 - 31920761
Alignment:
| Q |
104 |
gacagggaaatattcaaaaagagaaacaatgattaatgattgacaaaaaattggttgtacaaataatgtatcgaaaaggtggcaacaaattgtaagtact |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31920864 |
gacagggaaatattcaaaaagagaaacaatgattaatgattgacaaaaaattggttgtacaaataatgtatcgaaaaggtggcaacaaattgtaagtact |
31920765 |
T |
|
| Q |
204 |
atat |
207 |
Q |
| |
|
|||| |
|
|
| T |
31920764 |
atat |
31920761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 43
Target Start/End: Complemental strand, 31920950 - 31920922
Alignment:
| Q |
15 |
aatatattgatgatcatcaaagatcatta |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31920950 |
aatatattgatgatcatcaaagatcatta |
31920922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University