View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_high_30 (Length: 211)
Name: NF2332_high_30
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2332_high_30 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 156 - 211
Target Start/End: Complemental strand, 53562584 - 53562529
Alignment:
Q |
156 |
tgatgcatacagcagaacacgcagagcagcaacacagaaagcataagagctgctgc |
211 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53562584 |
tgatgcatacagcaaaacacgcagagcagcaacacagaaagcataagagctgctgc |
53562529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15739 times since January 2019
Visitors: 1170