View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_low_21 (Length: 353)
Name: NF2332_low_21
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2332_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 82 - 311
Target Start/End: Complemental strand, 31506021 - 31505789
Alignment:
| Q |
82 |
ccaactgcttagaacaatgtgcaaaactataactaagcctcagtta----gtaatataacattcatgttattattgtctagtagttgcttttcgtttaag |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31506021 |
ccaactgcttagaacaatgtgcaaaactataactaagcctcagttaattagtaatataacattcatgttattattgtctagtagttgcctttcgtttaag |
31505922 |
T |
 |
| Q |
178 |
gaaaactactatagtaaacacaggccgaggtatgtttagattagagatatttttatattgcattgtatagtagttaacagtattaaaccaaattccattc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| | |||||||||||||||||||| |
|
|
| T |
31505921 |
gaaaactactatagtaaacacaggccgaggtatgtttagattagagatatttttatattgcattgca-agtagttaatattattaaaccaaattccattc |
31505823 |
T |
 |
| Q |
278 |
catttctagcttgattaatacctaaaccctatat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31505822 |
catttctagcttgattaatacctaaaccctatat |
31505789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 31506104 - 31506076
Alignment:
| Q |
1 |
cagctttataaactaatccatgttcagag |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31506104 |
cagctttataaactaatccatgttcagag |
31506076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University