View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_low_28 (Length: 295)
Name: NF2332_low_28
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2332_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 16 - 144
Target Start/End: Original strand, 31788779 - 31788907
Alignment:
| Q |
16 |
atattatcaaatgttcattgatgagaaaggtacgtactgtaattaaagatgatcaaggtatgctcgatgaacaaggtattaggacaaggaaaatatttgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31788779 |
atattatcaaatgttcattgatgagaaaggtacgtactgtaattaaagatgatcaaggtatgctcgatgaacaaggtattaggacaaggaaaatatttgg |
31788878 |
T |
 |
| Q |
116 |
ggctatgatctatgattgggaagaacaag |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31788879 |
ggctatgatctatgattgggaagaacaag |
31788907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 134 - 277
Target Start/End: Original strand, 31789047 - 31789189
Alignment:
| Q |
134 |
ggaagaacaaggaaaattagtgttcaattttatcaaagatggagtttggaagaaaataaattcttggtaagacgttgtctggtgcaggtagaaaggttct |
233 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789047 |
ggaagaacaag--aaattagtgttcaattttatcaaagatggagtttggaagaaaataaattcttggtaagacgttgtctggtgcaggtagaaaggttct |
31789144 |
T |
 |
| Q |
234 |
tatcaagtgtgc-ttcggtgccataagaaatatttgtgcactgaa |
277 |
Q |
| |
|
|||||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
31789145 |
tatcaagtgtgctttcagtagcataagaaatatttgtgcactgaa |
31789189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 156 - 200
Target Start/End: Complemental strand, 23266071 - 23266027
Alignment:
| Q |
156 |
ttcaattttatcaaagatggagtttggaagaaaataaattcttgg |
200 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
23266071 |
ttcaactttatcaaagaccgtgtttggaagaaaataaattcttgg |
23266027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University