View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2332_low_44 (Length: 211)

Name: NF2332_low_44
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2332_low_44
NF2332_low_44
[»] chr4 (1 HSPs)
chr4 (156-211)||(53562529-53562584)


Alignment Details
Target: chr4 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 156 - 211
Target Start/End: Complemental strand, 53562584 - 53562529
Alignment:
156 tgatgcatacagcagaacacgcagagcagcaacacagaaagcataagagctgctgc 211  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
53562584 tgatgcatacagcaaaacacgcagagcagcaacacagaaagcataagagctgctgc 53562529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University