View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_low_46 (Length: 204)
Name: NF2332_low_46
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2332_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 42045707 - 42045591
Alignment:
| Q |
1 |
cctaactatacttcatatcactcatgcaaaccagaactagaattaattcaatataacacaccccaccaataccatgatgctaattttctccaacttccac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42045707 |
cctaactatacttcatatcactcatgcaaaccagaactagaattaattcaatataacacaccccaccaataccatgatgctaattttctccaacttccac |
42045608 |
T |
 |
| Q |
101 |
accttgaaagtccaaaa |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42045607 |
accttgaaagtccaaaa |
42045591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 77; Significance: 6e-36; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 110 - 186
Target Start/End: Complemental strand, 5401838 - 5401762
Alignment:
| Q |
110 |
gtccaaaatgtagcattgattataggcgtaacaggaattgtgggaaatagtctagcagagatcctacctctaaaaga |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5401838 |
gtccaaaatgtagcattgattataggcgtaacaggaattgtgggaaatagtctagcagagatcctacctctaaaaga |
5401762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 111 - 180
Target Start/End: Complemental strand, 5395690 - 5395621
Alignment:
| Q |
111 |
tccaaaatgtagcattgattataggcgtaacaggaattgtgggaaatagtctagcagagatcctacctct |
180 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
5395690 |
tccaaaatgtagcattgattataggcgtgacgggaattgtgggaaatagcctagcagagattctacctct |
5395621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 111 - 180
Target Start/End: Complemental strand, 5391880 - 5391811
Alignment:
| Q |
111 |
tccaaaatgtagcattgattataggcgtaacaggaattgtgggaaatagtctagcagagatcctacctct |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||| || ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
5391880 |
tccaaaatgtagcattaattataggcgtgacgggaattgtgggaaatagcctagcagagattttacctct |
5391811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University