View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2334_high_9 (Length: 237)

Name: NF2334_high_9
Description: NF2334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2334_high_9
NF2334_high_9
[»] chr4 (1 HSPs)
chr4 (1-174)||(49821402-49821577)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 49821402 - 49821577
Alignment:
1 ttttcaacaactccggtttgaagaacttcattgctcnnnnnnnnn--gctttctttaagaatacctattgtgaacgaagtgctcgcattcttgcatattg 98  Q
    ||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||||||||||||||||||||    
49821402 ttttcaacaactccggtttgaagaacttcattgctctttttttttttgctttctttaagaatacctattgtgaacgaagtgctcgcattcttgcatattg 49821501  T
99 catgatgtttggaaattggagatatacttatggaggatatttggtgtttagtatcttattgagttcgaaaggtgtg 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49821502 catgatgtttggaaattggagatatacttatggaggatatttggtgtttagtatcttattgagttcgaaaggtgtg 49821577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University