View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2334_low_5 (Length: 296)
Name: NF2334_low_5
Description: NF2334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2334_low_5 |
 |  |
|
| [»] chr4 (141 HSPs) |
 |  |
|
| [»] chr2 (116 HSPs) |
 |  |
|
| [»] scaffold0778 (1 HSPs) |
 |  |
|
| [»] chr8 (138 HSPs) |
 |  |
|
| [»] chr1 (123 HSPs) |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0432 (1 HSPs) |
 |  |
|
| [»] scaffold0402 (1 HSPs) |
 |  |  |
|
| [»] scaffold0595 (1 HSPs) |
 |  |  |
|
| [»] scaffold0287 (1 HSPs) |
 |  |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0515 (1 HSPs) |
 |  |  |
|
| [»] scaffold0306 (1 HSPs) |
 |  |  |
|
| [»] scaffold0244 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |
|
| [»] scaffold0457 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0882 (1 HSPs) |
 |  |  |
|
| [»] scaffold0548 (1 HSPs) |
 |  |  |
|
| [»] scaffold0163 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0633 (1 HSPs) |
 |  |  |
|
| [»] scaffold0502 (1 HSPs) |
 |  |  |
|
| [»] scaffold0242 (2 HSPs) |
 |  |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0364 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 155)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 5 - 291
Target Start/End: Original strand, 47570084 - 47570382
Alignment:
| Q |
5 |
gagtgagatgaataagtgtagtgtctcttactatggaccctatatatacagtgggtgatgggtgggaggtgaatgaatctactatctatctattcaacaa |
104 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47570084 |
gagtgaaaagaataagtgtagtgtctcttactatggtccctatatatatagtgggtgatgggtgggaggtgaatgaatctactatctatctattcaacaa |
47570183 |
T |
 |
| Q |
105 |
tattaattgctgttgtaaatacagtcaaataa-taaaatcaatttttcttaaagataaattagtcattttaaaccaacaataaaataatccaaatggtat |
203 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47570184 |
tattaattgctggtgtaaatacagtcaaataattaaaatcaatttttcttaaagataaattagtcattttaaaccaacaatagaataatccaaatggtat |
47570283 |
T |
 |
| Q |
204 |
ccagaagt-----------tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||| |||| | ||||||||| ||||||||| || ||||||||| ||| ||||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
47570284 |
ccaaaagtcctagctcaactcacaaaatgtcaaaattgttaagccggatgtcataatcagggttcgaaccccggtacctccatttatgtgtgtgagttt |
47570382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 24910396 - 24910317
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24910396 |
tggcaaaatgccgaaattgttaggctggatatcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
24910317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 24650655 - 24650571
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24650655 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa |
24650571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 3917786 - 3917865
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3917786 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
3917865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 28197092 - 28197013
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28197092 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
28197013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 212 - 294
Target Start/End: Complemental strand, 6583343 - 6583261
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttat |
294 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
6583343 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtgcctccacttgtgtgtgtgagttttat |
6583261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 12088391 - 12088311
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12088391 |
ttggaaaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
12088311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 1242237 - 1242316
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1242237 |
tggcaaaatgccgaaattattaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
1242316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 4232285 - 4232206
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4232285 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
4232206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 8381099 - 8381178
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8381099 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
8381178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 11029688 - 11029763
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11029688 |
aaaatgtcgaaattgttaggctggatgccatgaccagggttcgaaccccggtacctccacttgtgtgtgtgagttt |
11029763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 13525189 - 13525268
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13525189 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
13525268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 32635399 - 32635478
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
32635399 |
tggcaaaatgtcgaaattattaggtcggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgcgagttt |
32635478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 33886478 - 33886399
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33886478 |
tggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
33886399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 47410860 - 47410781
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
47410860 |
tggcaaaatgtcgaaattgttaggtcggatgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
47410781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 52256856 - 52256781
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52256856 |
aaaatgtcgatattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
52256781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 217 - 291
Target Start/End: Complemental strand, 8128393 - 8128319
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8128393 |
aaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
8128319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 215 - 296
Target Start/End: Original strand, 9609955 - 9610036
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||| |||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
9609955 |
caaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttttataa |
9610036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 215 - 296
Target Start/End: Original strand, 28266549 - 28266630
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||| |||||||||||| ||||| |||| ||||||||||||||||||||||| |
|
|
| T |
28266549 |
caaaatgccgaaattgttaggctggatgccatgaccggggttcgaactccggtgcctccacttgtgtgtgtgagttttataa |
28266630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 43605684 - 43605600
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| ||| ||||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43605684 |
tggcaaaatgctgaatttgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa |
43605600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 1218475 - 1218400
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
1218475 |
aaaatgccgaaattgttaggccggatgccatgatcggggttcgaacctcggtacctctacttgtgtgtgttagttt |
1218400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 3440750 - 3440825
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3440750 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
3440825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 4833217 - 4833138
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4833217 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttgtgtgtgtgagttt |
4833138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 9493522 - 9493597
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
9493522 |
aaaatgtcgaaattgttaggctggatgccatgactggggttcgaaccccggtacctccacttgtatgtgtgagttt |
9493597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 10228977 - 10229056
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10228977 |
tggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
10229056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 10474022 - 10473943
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10474022 |
tggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
10473943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 287
Target Start/End: Original strand, 24751773 - 24751848
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
24751773 |
tggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccctggtaccttcacttgtgtgtgtga |
24751848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 28171083 - 28171008
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28171083 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggcacctctacttgtgtgtgtgagttt |
28171008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 30703115 - 30703190
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
30703115 |
aaaatatcgaaattgttaggctggatgtcatgaccggggttcgaaccccgttacctccacttgtgtgtgagagttt |
30703190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 32590996 - 32591071
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||| ||||| |
|
|
| T |
32590996 |
aaaatgtcgaaattgttaggccggatgccatgatcggggttcgaatcccggtacctccacttgtgtgtgtcagttt |
32591071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 32961086 - 32961007
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| |||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32961086 |
tggcaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
32961007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 34397700 - 34397779
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||| | |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
34397700 |
tggcaaaatgccgaaattgttaggccggatgtcataaccggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
34397779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 35359737 - 35359816
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| | ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35359737 |
tggcaaaatgccgaaattgttaggccggatgccatgaccagggttcgaaccccggtacctccacttgtgtgtgtgagttt |
35359816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 38127950 - 38127871
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||| |||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
38127950 |
tggcaaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggttcctccacttgtgtgtgtgagttt |
38127871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 47069031 - 47069106
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47069031 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
47069106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 50238944 - 50238869
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
50238944 |
aaaatgtcgaaattgttaggccggatgccatgatcggagttcgaactccggtacctccacttgtgtgtgtgagttt |
50238869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 212 - 290
Target Start/End: Original strand, 2687579 - 2687657
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtt |
290 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||||||||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
2687579 |
tggcaaaatgccgaaattgttaggccggatggcatgatcggggttcgaaccctgatacctccacttgtgtgtgtgagtt |
2687657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 212 - 286
Target Start/End: Complemental strand, 29212173 - 29212099
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29212173 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
29212099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 212 - 286
Target Start/End: Original strand, 35069333 - 35069407
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35069333 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
35069407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 215 - 296
Target Start/End: Original strand, 8826648 - 8826729
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
||||||| |||||||||||| | ||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8826648 |
caaaatgccgaaattgttagaccggatgctatgatcggggctcgaaccccggtacctccacttgtgtgtgtgagttttataa |
8826729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 218 - 286
Target Start/End: Complemental strand, 2096687 - 2096619
Alignment:
| Q |
218 |
aatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2096687 |
aatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
2096619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 28731870 - 28731946
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
28731870 |
caaaatgtcgaaattgttaggtcggatgccatgatcggggttcgaatcccggtaccttcacttgtgtgtgtgagttt |
28731946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 37124236 - 37124320
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| | ||| ||||| ||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
37124236 |
tggcaaaatgccgaaattgttaggccgaatgccatgaccggggttcgaacctcggtacctccccttgtgtgtgtgagttttataa |
37124320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 43898068 - 43897992
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||| |||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43898068 |
caaaatgccgaaattgttaggccggatgccatgaccgggattcgaaccccggtacctccacttgtgtgtgtgagttt |
43897992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 1339244 - 1339319
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
1339244 |
aaaatgtcgaaattgtttgatcggatgtcatgatcggggttcgaaccccggtccctccacttgtgtgtgtgagttt |
1339319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 4976816 - 4976737
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
4976816 |
tggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgttagttt |
4976737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 44037552 - 44037473
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| |||||| |||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
44037552 |
tggcaaaatgccgaaattgttaggtcggatgtcgtgatcgaggttcgaatcccggtacctctacttatgtgtgtgagttt |
44037473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 48191118 - 48191193
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| |||||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
48191118 |
aaaatgccgaaattgttaggccggatgtcatgaccggggttcgaactccagtacctccacttgtgtgtgtgagttt |
48191193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 212 - 286
Target Start/End: Original strand, 11312610 - 11312684
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11312610 |
tggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
11312684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 214 - 284
Target Start/End: Original strand, 42296733 - 42296803
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||| | |||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42296733 |
gcaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtg |
42296803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 211 - 296
Target Start/End: Original strand, 24250744 - 24250829
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| |||| |||||||||||||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
24250744 |
ttggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtgccttcatttgtgtgtgtgagttttataa |
24250829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 214 - 287
Target Start/End: Complemental strand, 25118812 - 25118739
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| | ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
25118812 |
gcaaaatgtcgaaattgttaggccggatgccatgaccagggttcgaaccccggtacctccacctgtgtgtgtga |
25118739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 217 - 290
Target Start/End: Original strand, 35240055 - 35240128
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtt |
290 |
Q |
| |
|
||||| |||||||||||||| ||||| | ||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35240055 |
aaatgccgaaattgttaggccggatgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtt |
35240128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 216 - 284
Target Start/End: Original strand, 1562819 - 1562887
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1562819 |
aaaatgccgaaattgttaggtcggatgtcatgatcggggttcgaaccccggtaccttcacttgtgtgtg |
1562887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 16135025 - 16135101
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| |||||||| ||||||||||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
16135025 |
caaaatgccgaaattgttaggtcggatgtcaagatcggggttcgaaccccgctacctccacttatgtgtgtgagttt |
16135101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 27396877 - 27396952
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
27396877 |
caaaatgccgaaattgttaggccggatgccatgaccggggttcgaa-cccggtacctccacttgtgtgtgtgagttt |
27396952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 34481889 - 34481821
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34481889 |
cgaaattgttaggccggatgacatgaccggggttcgaacttcggtacctctacttgtgtgtgtgagttt |
34481821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 216 - 284
Target Start/End: Original strand, 40840193 - 40840261
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40840193 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtg |
40840261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 44879341 - 44879262
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggt-acctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||| ||||||||| ||||| |||||||||||||||||| |
|
|
| T |
44879341 |
tggcaaaatgtcgaaattgttaggccagatgtcatgaccggggttc-aaccccggtcacctccacttgtgtgtgtgagttt |
44879262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 45475329 - 45475261
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| |||||| ||||| ||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
45475329 |
cgaaattgttaggccggatgttatgattggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
45475261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 2558767 - 2558846
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||| |||||||| |||||| |||| ||||||||||||| |
|
|
| T |
2558767 |
tggcaaaatgctgaaattgttaggtcggatgtcatgatcggggtttgaaccccgatacctccacttatgtgtgtgagttt |
2558846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 15003648 - 15003727
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | ||||||||||| ||||||||||| ||||||||||||||||||||||| || | ||||||||||||| |
|
|
| T |
15003648 |
tggcaaaatgccaaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacctatgtgtgtgagttt |
15003727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 30553076 - 30552997
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||| | ||||| ||||| ||| |||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
30553076 |
tggcaaaatgccgaaattgttagaccggatgccatgaccggagttcgaaccccgatacctccacttgtgtgtgtgagttt |
30552997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 43967956 - 43968022
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
43967956 |
gaaattgttaggccggatgtcatgatcagggttcgaaccccggta-ctccacttgtgtgtgtgagttt |
43968022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 44107401 - 44107479
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| ||||||||||||| ||||| ||||| ||||| ||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
44107401 |
tggcaaaatgttgaaattgttaggccggatgccatgaccgggg-tcgaacctcggtacctccacttgtgtgtgtgagttt |
44107479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 54097548 - 54097470
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||| |||||||||| |||| |||||||||||||||||| |
|
|
| T |
54097548 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttggaaccccggt-cctccacttgtgtgtgtgagttt |
54097470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 217 - 291
Target Start/End: Complemental strand, 5998884 - 5998811
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| |||||||||||||||| || ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5998884 |
aaatgccgaaattgttaggctg-ataccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
5998811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 11751236 - 11751306
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||| | ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11751236 |
aaaatgccgaaattgttaggccggatgccatcaccggggttcgaaccccggtacctccacttgtgtgtgtg |
11751306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 212 - 286
Target Start/End: Original strand, 41464684 - 41464758
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
41464684 |
tggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccagtacctccacttgtgtgtgtg |
41464758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 216 - 296
Target Start/End: Original strand, 12948834 - 12948912
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||||||||||||||||||||| ||| || ||| |||||||||||||||||| |
|
|
| T |
12948834 |
aaaatgacgaaattgttaggccggatgccatgatcggggttcgaaccccgatacttccact--tgtgtgtgagttttataa |
12948912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 215 - 288
Target Start/End: Original strand, 24657434 - 24657507
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgag |
288 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||| | ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24657434 |
caaaatgccgaaattgttaggcaggatgccatggccagggttcgaaccccggtacctccacttgtgtgtgtgag |
24657507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 6419774 - 6419694
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||| | | ||||||||| ||||||| | |||||| ||||||||||| |
|
|
| T |
6419774 |
ttggtaaaatgtcgaaattgttaggccggatgtcatgaccagcgttcgaaccgcggtacccccacttgtatgtgtgagttt |
6419694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 216 - 284
Target Start/End: Complemental strand, 8792833 - 8792765
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||| ||||||||||||||||||| | ||||||||||| |
|
|
| T |
8792833 |
aaaatgccgaaattgttaggctggatgccatgattggggttcgaaccccggtacattcacttgtgtgtg |
8792765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 11249992 - 11250052
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11249992 |
gaaattgttaggtcggatgccatgatcggggttcgaaccctggtacctctacttgtgtgtg |
11250052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 215 - 287
Target Start/End: Original strand, 38085829 - 38085901
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||| ||||||||||||| ||| ||||||||| |||| |
|
|
| T |
38085829 |
caaaatgtcgaaattgttaggccgaatgacatgatcggggctcgaaccccggtaactccacttgtgtgcgtga |
38085901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 284
Target Start/End: Complemental strand, 40418571 - 40418511
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40418571 |
gaaattgttaggccaaatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtg |
40418511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 2789086 - 2789008
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||| |||||| |||| ||||| ||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
2789086 |
tggcaaaatgccgaaattattaggcctgatgccatgaccggggttcgaaccccggtacctccacttgtgt-tgtgagttt |
2789008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 8507956 - 8508031
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
8507956 |
aaaatgccgaaattgttaggccggatgccatgactggggttcaaaccccggtacctccacttatgtgtgtgagttt |
8508031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 9583527 - 9583452
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||| ||||||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
9583527 |
aaaatgccgaaattgttaggccggatgctatgaccggggttagaaccccgatacctccacttgtgtgtgtgagttt |
9583452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 27002848 - 27002769
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| || ||||||||||| || ||||| ||||| | | ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27002848 |
tggcaaagtgccgaaattgttaagccggatgccatgaccagagttcgaaccccggtacctccacttgtgtgtgtgagttt |
27002769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 40193060 - 40192985
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| |||||||||| |||||| | |||||||||||||||| |
|
|
| T |
40193060 |
aaaatgtcgaaattgttaggccggatgccatgatcggagttcgaacccttatacctccatttgtgtgtgtgagttt |
40192985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 40559698 - 40559773
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| ||||| | |||||||||||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
40559698 |
aaaatgccgaaattgttaggtcggatgccttgatcggggttcgaactccgatacctccacttgtgtgtgtgagttt |
40559773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 43904599 - 43904524
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| |||||||| ||||| |||||||| | || ||||||||||||| |
|
|
| T |
43904599 |
aaaatgtcgaaattgttaggccggatgccatgaccggggttcaaaccctggtacctccatttatgtgtgtgagttt |
43904524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 46838831 - 46838756
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||| |||||| ||||||||| |||||||||||||||||| |
|
|
| T |
46838831 |
aaaatgccgaaattgttaggccggatgccatgaccggggctcgaactccggtaccttcacttgtgtgtgtgagttt |
46838756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 48555856 - 48555935
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||| |||| ||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48555856 |
tggcaaaatgccaaaattgttaggccagatgctatggccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
48555935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 217 - 287
Target Start/End: Complemental strand, 14868958 - 14868888
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||| ||||||||||||||||||| ||||| ||||||| ||||||||||||||| |||| ||||||||| |
|
|
| T |
14868958 |
aaatgccgaaattgttaggctggataccatgaccggggtttgaaccccggtacctccacttatgtgtgtga |
14868888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 212 - 286
Target Start/End: Original strand, 53583981 - 53584055
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||| |||||| ||||||| | |||||| ||||||||||||| |
|
|
| T |
53583981 |
tggcaaaatgtcgaaattgttaggccggattccatgaccggggtacgaacccagatacctccacttgtgtgtgtg |
53584055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 6083247 - 6083171
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||||| |||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
6083247 |
gcaaaatgccgaaattgttaggccggataccatgaccggg-ttcgaactccggtacctccacttgtgtgtgtgagttt |
6083171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 225 - 290
Target Start/End: Complemental strand, 32630710 - 32630645
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtt |
290 |
Q |
| |
|
||||||||| ||||||||||||||| || ||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
32630710 |
aaattgttaagctggatgtcatgattggagttcgaacctcggtacctccacttatgtgtgtgagtt |
32630645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 5350015 - 5349947
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| | || ||| ||||||||| |
|
|
| T |
5350015 |
cgaaattgttaggccggataccatgatcggggttcgaaccccggtacctccatttatgtttgtgagttt |
5349947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 7552626 - 7552694
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||| | ||| ||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
7552626 |
cgaaattgttaggccggatgccgtgaccggggttcgaaccccaatacctccacttgtgtgtgtgagttt |
7552694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 10047891 - 10047971
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| |||||| ||||||||||| || ||||| ||||| |||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
10047891 |
ttggtaaaatgccgaaattgttatgccggatgccatgaccggggttcgaactctggtaccttcacttgtgtgtgtgagttt |
10047971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 24273985 - 24273909
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||| |||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
24273985 |
caaaatgccgaaattgttaggccggatgccatgactagggttcgaacttcggtacctccacttgtgtgtgtgagttt |
24273909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 212 - 284
Target Start/End: Original strand, 39172060 - 39172132
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||||| |||||||||||| | |||||||||| ||||||| |||||| ||||||| | ||||||||| |
|
|
| T |
39172060 |
tggcaaaatgtcaaaattgttaggccgaatgtcatgattggggttcaaaccccagtacctccatttgtgtgtg |
39172132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 46894836 - 46894912
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||||| || ||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
46894836 |
caaaatatcgaaattgttaggccggatgccatgaccgaggttcgaaccccgataccttcacttatgtgtgtgagttt |
46894912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 227 - 291
Target Start/End: Original strand, 51402858 - 51402922
Alignment:
| Q |
227 |
attgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||| || ||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
51402858 |
attgttaggccggatgtcaagaacggagttcgaactccggtacctccacttgtgtgtgtgagttt |
51402922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 10071620 - 10071545
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||||||||| |||| |||||||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
10071620 |
aaaatgtcaaaattgttaggctggatgccatggtcggggttcgaaccccaacacctgcacttgtgcgtgtgagttt |
10071545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 46316581 - 46316506
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| ||||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
46316581 |
aaaatgccgaaattgttaggtcggatgtcatgactagggtttgaaccctgatacctctacttgtgtgtgtgagttt |
46316506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 242 - 291
Target Start/End: Original strand, 21129096 - 21129146
Alignment:
| Q |
242 |
gtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
21129096 |
gtcatgatcggggttcgaaccccggtacctctactttgtgtttgtgagttt |
21129146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 216 - 285
Target Start/End: Complemental strand, 18462060 - 18461991
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgt |
285 |
Q |
| |
|
|||||||||||||| |||| | |||||||| |||||||||||||||||| |||||| |||| ||||||| |
|
|
| T |
18462060 |
aaaatgtcgaaattattagaccggatgtcaagatcggggttcgaacccccatacctccacttatgtgtgt |
18461991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 243 - 291
Target Start/End: Original strand, 11076456 - 11076504
Alignment:
| Q |
243 |
tcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
11076456 |
tcatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
11076504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 29216825 - 29216905
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| |||| ||| |||| |||||||||||| | |||| ||||||||||||| |
|
|
| T |
29216825 |
ttggaaaaatgtcgaaattgttaggccggatactatgaccggagttcaaaccccggtaccgccacttatgtgtgtgagttt |
29216905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 211 - 287
Target Start/End: Complemental strand, 46800141 - 46800066
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| |||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
46800141 |
ttggcaaaatgccgaaattgttagatcggatgtcatgactggggtttgaa-cccggtacctccacttgtgtgtgtga |
46800066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 284
Target Start/End: Original strand, 49443127 - 49443195
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| || ||||||||||||||||||| |||| |||||| |
|
|
| T |
49443127 |
aaaatgtcgaaattgttaggcatgatgtaatgactggagttcgaaccccggtacctccacttatgtgtg |
49443195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 17500951 - 17501026
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||| || ||| || |||||||||||||||||| |
|
|
| T |
17500951 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaaccaaatacatccacttgtgtgtgtgagttt |
17501026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 22371470 - 22371548
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||| | || |||| | |||||||||| ||||| |
|
|
| T |
22371470 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccacagt-cctccatttgtgtgtgtaagttt |
22371548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 23878970 - 23879045
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| | |||||||||||| |||||||||| || |||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
23878970 |
aaaatgcctaaattgttaggccagatgtcatgactggagttcgaaccccgatacctccacttatgtgtgtgagttt |
23879045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 36540129 - 36540204
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | ||||||||||||| ||| | ||||| |||||||||||| |
|
|
| T |
36540129 |
aaaatgtcgaaattgttaggccagatgtcatgactgaggttcgaaccccgatactttcacttgcgtgtgtgagttt |
36540204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 43426592 - 43426667
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| |||| ||||| ||| ||||||||||||||||||| |||| ||||| ||||||| |
|
|
| T |
43426592 |
aaaatgccgaaattgttaggtcagatgccatgaccggagttcgaaccccggtacctccacttatgtgtatgagttt |
43426667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 244 - 291
Target Start/End: Original strand, 44791760 - 44791807
Alignment:
| Q |
244 |
catgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
44791760 |
catgatcggggttcgaaccccgttacctccacttatgtgtgtgagttt |
44791807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 2947817 - 2947763
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| | ||||||| |||| |
|
|
| T |
2947817 |
cgaaattgttaggccggatgtcatgaccggggttcgaaccacagtacctccactt |
2947763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 212 - 246
Target Start/End: Original strand, 9318538 - 9318572
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9318538 |
tggcaaaatgtcgaaattgttaggctggatgtcat |
9318572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 213 - 291
Target Start/End: Complemental strand, 16687655 - 16687579
Alignment:
| Q |
213 |
ggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| |||||||||||||| ||| ||||| |||||||||||||| |||||||| | |||||||||||||||| |
|
|
| T |
16687655 |
ggcaaaatgccgaaattgttaggccggacc-catgaccggggttcgaacccaggtacctcca-ttgtgtgtgtgagttt |
16687579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 212 - 282
Target Start/End: Complemental strand, 21893358 - 21893288
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtg |
282 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| | ||||||||| |||||||||| || |||||| |
|
|
| T |
21893358 |
tggcaaagtgtcgaaattgttaggtcagatgtcatgattgaggttcgaactccggtacctccacgtgtgtg |
21893288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 245 - 291
Target Start/End: Complemental strand, 38486034 - 38485988
Alignment:
| Q |
245 |
atgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| |||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
38486034 |
atgaccggggttcgaactccggtacctccacttgtgtgtgtgagttt |
38485988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 215 - 268
Target Start/End: Original strand, 19961392 - 19961445
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggta |
268 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
19961392 |
caaaatgtcgaaattgttaggtcggatgtcatgactggggttcgtaccccggta |
19961445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 18271600 - 18271675
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||||| ||||| ||| | ||||||||| |||||||| ||||||||| |
|
|
| T |
18271600 |
caaaatgccgaaattgttaggtcggatgccatgatc-gggtttgaatctcggtacctccacttgtgtatgtgagttt |
18271675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 291
Target Start/End: Original strand, 19163697 - 19163733
Alignment:
| Q |
255 |
ttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19163697 |
ttcgaaccccggtacctccacttgtgtgtgtgagttt |
19163733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 19921421 - 19921341
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| |||||||||||| ||||| ||||| | |||||||||||| || |||| |||| ||||||||||||| |
|
|
| T |
19921421 |
ttggcaaaatgctgaaattgttaggtcggatgccatgactgaggttcgaaccccagttcctccacttatgtgtgtgagttt |
19921341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 21569311 - 21569235
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| | ||||||||||| ||||||||||| ||| ||||||||||| ||||| ||| |||||||||| |||| |
|
|
| T |
21569311 |
caaaatgacaaaattgttaggacggatgtcatgaccggtattcgaaccccgatacctttacatgtgtgtgtgggttt |
21569235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 296
Target Start/End: Complemental strand, 42483031 - 42482951
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||| |||||||||||| | |||||||||||| | | | |||||||||||||||| |||| ||| |||||||||||| |
|
|
| T |
42483031 |
aaaatgccgaaattgttagaccggatgtcatgattgtgttacgaaccccggtacctccactttgatgtatgagttttataa |
42482951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 46311547 - 46311474
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| ||| ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
46311547 |
aaaatgtcgaaattgttaggccggatgctatgaccgg--ttcgaaccctaatacctccacttgtgtgtgtgagttt |
46311474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 49285531 - 49285607
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| | |||| ||| ||||||| ||| | | |||||||||||| ||||||||||||| |
|
|
| T |
49285531 |
caaaatgtcgaaattgttaggtcgaatgttttgaccggggtttgaaactcagtacctctacttatgtgtgtgagttt |
49285607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 291
Target Start/End: Complemental strand, 51367754 - 51367687
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctcta-cttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| ||||||| |||||||||||| |||||| ||||||||| |
|
|
| T |
51367754 |
gaaattgttaagctggatgttatgatcggg-ttcgaactccggtacctctattttgtgtatgtgagttt |
51367687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 2900275 - 2900354
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||| || ||||||||| | || ||| ||| || ||||| || |||||||||||||||||| |
|
|
| T |
2900275 |
tggcaaaatgccgaaattgttaagccggatgtcataaccgaagtttgaatcctggtacatccacttgtgtgtgtgagttt |
2900354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 263
Target Start/End: Original strand, 10662008 - 10662055
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccc |
263 |
Q |
| |
|
|||||| ||||||||||||| |||| |||||| ||||||||||||||| |
|
|
| T |
10662008 |
aaaatgccgaaattgttaggttggacgtcatggtcggggttcgaaccc |
10662055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 287
Target Start/End: Original strand, 17373695 - 17373766
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||| ||||||||||| || ||||| ||||| | ||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
17373695 |
aaaatgccgaaattgttaagccggatgccatgactgaggttcgaactccgctacctccacttgtgtgtgtga |
17373766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 224 - 287
Target Start/End: Original strand, 32956802 - 32956865
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||||||||||| || ||||||| ||||||||||||||| ||||||| | || ||||||||| |
|
|
| T |
32956802 |
gaaattgttaggccagacgtcatgaccggggttcgaaccccagtacctccatttatgtgtgtga |
32956865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 43564212 - 43564287
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||| ||||| | |||||||| |||||||| ||| |||||| || ||| ||| ||||||| |
|
|
| T |
43564212 |
aaaatgttgaaattgttaggttggatattatgatcggagttcgaactccgatacctccacctgtttgtatgagttt |
43564287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 214 - 265
Target Start/End: Original strand, 51053640 - 51053691
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccg |
265 |
Q |
| |
|
|||||||| ||||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
51053640 |
gcaaaatgccgaaattgttaggtcgaacgtcatgatcggggttcgaaccccg |
51053691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 217 - 284
Target Start/End: Complemental strand, 51112567 - 51112500
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||| |||||||| ||||| ||| ||||||| ||||||||||||||| || || | ||||||||||| |
|
|
| T |
51112567 |
aaatgccgaaattgctaggccggacgtcatgaccggggttcgaaccccagtgcccccacttgtgtgtg |
51112500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 224 - 291
Target Start/End: Complemental strand, 53669807 - 53669740
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||| ||||| || |||||||||||||| ||| | |||||||||||||||| |
|
|
| T |
53669807 |
gaaattgttaggccggatgccatgactggagttcgaaccccggttccttcatttgtgtgtgtgagttt |
53669740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 228 - 291
Target Start/End: Original strand, 55068963 - 55069026
Alignment:
| Q |
228 |
ttgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||||||||| |||||| |||| | ||||| ||||| |
|
|
| T |
55068963 |
ttgttaggctgaatgccatgatcgggattcgaaccccgatacctccacttatatgtgtaagttt |
55069026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 220 - 274
Target Start/End: Complemental strand, 20625748 - 20625694
Alignment:
| Q |
220 |
tgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctcta |
274 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||| | ||||||||||| |
|
|
| T |
20625748 |
tgtcgaaattgttaggtcggatgccatgatcagggttcgaatctcggtacctcta |
20625694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 244 - 286
Target Start/End: Complemental strand, 32597423 - 32597381
Alignment:
| Q |
244 |
catgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
32597423 |
catgaccggggttcgaatcccggtacctccacttgtgtgtgtg |
32597381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 34844013 - 34844083
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||| |||||||||| || ||| | ||||| || |||||||||||||| ||||| |||||||||||| |
|
|
| T |
34844013 |
aaaatgttgaaattgttatgccggacgccatgaccgaggttcgaaccccggcacctccccttgtgtgtgtg |
34844083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 257
Target Start/End: Original strand, 10514572 - 10514613
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttc |
257 |
Q |
| |
|
|||||| |||||||||||||| |||||||||| ||||||||| |
|
|
| T |
10514572 |
aaaatgccgaaattgttaggccggatgtcatggtcggggttc |
10514613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 289
Target Start/End: Complemental strand, 21402766 - 21402689
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagt |
289 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||||||||||||||||| ||| || |||| |||| |||||| |
|
|
| T |
21402766 |
tggcaaaatgccgaaattgttaaatcagatgttatgatcggggttcgaaccccgatacttccacttatgtgggtgagt |
21402689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 211 - 284
Target Start/End: Complemental strand, 23526015 - 23525942
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||| |||||||| ||||||||||| ||||| |||||||||||| ||| |||||||||| |||| |||||| |
|
|
| T |
23526015 |
ttggtaaaatgtcaaaattgttaggtcggatgctatgatcggggttataactccggtacctccacttatgtgtg |
23525942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 296
Target Start/End: Complemental strand, 26764526 - 26764489
Alignment:
| Q |
259 |
aaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
26764526 |
aaccccggtgcctccacttgtgtgtgtgagttttataa |
26764489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 217 - 274
Target Start/End: Complemental strand, 33746079 - 33746023
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctcta |
274 |
Q |
| |
|
||||| ||||||||||||| ||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
33746079 |
aaatgccgaaattgttaggtcggatgtcatga-ctgggttcaaaccccggtacctcta |
33746023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 261
Target Start/End: Complemental strand, 35208161 - 35208124
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaac |
261 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35208161 |
gaaattgttaggccggatgtcatgaccggggttcgaac |
35208124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 286
Target Start/End: Original strand, 47408862 - 47408935
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttc-gaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||||| ||||||| |||| |||||||||| |||| |||||||| |
|
|
| T |
47408862 |
gcaaaatgccgaaattgttaggccggataccatgaatggggttcggaactccggtacctccacttatgtgtgtg |
47408935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 217 - 262
Target Start/End: Original strand, 52500863 - 52500908
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaacc |
262 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||||| ||||||||||| |
|
|
| T |
52500863 |
aaatgtcgaaattgtaaggccggacgtcatgatccgggttcgaacc |
52500908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 261
Target Start/End: Original strand, 54923510 - 54923555
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaac |
261 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
| T |
54923510 |
aaaatgtcgaaattgttaggtcggacgtcatgaccggggttcgaac |
54923555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 284
Target Start/End: Original strand, 2666234 - 2666306
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||| | ||||||||||||| | || |||||| ||||||| || |||| |||||| ||||||||||| |
|
|
| T |
2666234 |
tggcaaaatcttgaaattgttaggccgtatatcatgaatggggttcaaatcccgatacctccacttgtgtgtg |
2666306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 272
Target Start/End: Original strand, 2861076 - 2861132
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctc |
272 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| || |||||||| |||||||||| |
|
|
| T |
2861076 |
aaaatgtcgaaattgttaggtcggacgtcatgaccgaagttcgaactccggtacctc |
2861132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 211 - 267
Target Start/End: Original strand, 12405582 - 12405638
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggt |
267 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| ||||||||| |||||| |
|
|
| T |
12405582 |
ttggcaaaatatcgaaattgttaggtcggatgtcaatatcagggttcgaatcccggt |
12405638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 33096002 - 33096078
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| | | |||||||| ||||||| ||| ||| ||||| || |||||||||||||||| |
|
|
| T |
33096002 |
aaaatgacgaaattgttaggccgaacgtcatgattggggttcaaactccgacacctccactttgtgtgtgtgagttt |
33096078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 36518123 - 36518199
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||| ||||| ||||| ||| | | |||||||| | ||||| |||| |||||||||||||||||| |
|
|
| T |
36518123 |
caaaatgccgaaattattaggtcggatgccataaccagggttcgacctccggttcctccacttgtgtgtgtgagttt |
36518199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 37312559 - 37312627
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||| | | ||| |||||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
37312559 |
cgaaattgttaggccggacgccttgacgggggttcgaacccccgcccctccacttgtgtgtgtgagttt |
37312627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Complemental strand, 39922727 - 39922683
Alignment:
| Q |
240 |
atgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||| |||| || |||||||||||||| |||||||||||| |
|
|
| T |
39922727 |
atgtcatgaccgggatttgaaccccggtacctttacttgtgtgtg |
39922683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 40639633 - 40639701
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||| | | ||| |||||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
40639633 |
cgaaattgttaggccggacgccttgacgggggttcgaacccccgcccctccacttgtgtgtgtgagttt |
40639701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 46828917 - 46828993
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||| | |||| ||||||| | ||||| |||||||| || |||||| |
|
|
| T |
46828917 |
caaaatgtcgaaattattaggccggatgccatgaccatggtttgaaccccagaacctccacttgtgtatgcgagttt |
46828993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 47665314 - 47665238
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||| || ||||||||||| |||| || |||||| || || ||||||||||||| |
|
|
| T |
47665314 |
aaaatgtcgaaattgttaggccggacatcttgatcggggtttgaactccaatacctccactttatgtgtgtgagttt |
47665238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 72; Significance: 9e-33; HSPs: 127)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 3861444 - 3861365
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3861444 |
tggcaaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
3861365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 46734220 - 46734145
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
46734220 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccgttacctccacttgtgtgtgtgagttt |
46734145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 2228188 - 2228109
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
2228188 |
tggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggtacctccacttgtatgtgtgagttt |
2228109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 5508705 - 5508784
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5508705 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
5508784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 21226085 - 21226164
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21226085 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
21226164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 27396422 - 27396343
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27396422 |
tggcaaaatgccgaaattgttaggccggatgccatgattggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
27396343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 35157192 - 35157113
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
35157192 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
35157113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 35849315 - 35849394
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| || |||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35849315 |
tggcaaagtgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
35849394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 212 - 284
Target Start/End: Original strand, 9380011 - 9380083
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
9380011 |
tggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccccagtacctccacttgtgtgtg |
9380083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 43133200 - 43133132
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43133200 |
cgaaattgttaggctgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
43133132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 3497625 - 3497546
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
3497625 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
3497546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 4069224 - 4069145
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4069224 |
tggcaaaataccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
4069145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 4106578 - 4106653
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4106578 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
4106653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 287
Target Start/End: Complemental strand, 7312561 - 7312486
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||| | |||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7312561 |
tggcaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
7312486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 10061124 - 10061045
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10061124 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtgtgagttt |
10061045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 10422498 - 10422577
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10422498 |
tggcaaaatatcgaaattgttaggtcggatgccatgatcggggttcgaatcccggtacctccacttgtgtgtgtgagttt |
10422577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 16816711 - 16816790
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
16816711 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccgcggtacctccacttgtgtgtgtgagttt |
16816790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 17895654 - 17895733
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17895654 |
tggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
17895733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 19258448 - 19258523
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19258448 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
19258523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 29151603 - 29151682
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29151603 |
tggcaaaatgctgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
29151682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 30627648 - 30627723
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30627648 |
aaaatgtcgaaattgttagatcggatgtcatgatcgaggttcgaaccccggtacctccacttgtgtgtgtgagttt |
30627723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 45236950 - 45237029
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||||||||| |||||| |||||||| ||||||||| |
|
|
| T |
45236950 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccgatacctccacttgtgtatgtgagttt |
45237029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 47584779 - 47584700
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| ||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
47584779 |
tggcaaaatgtcgacattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
47584700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 48729792 - 48729713
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
48729792 |
tggcaaaatgccgaaattgttaggccggatgtcatgatcgtggttcgaattccggtacctccacttgtgtgtgtgagttt |
48729713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 201 - 291
Target Start/End: Complemental strand, 28019999 - 28019909
Alignment:
| Q |
201 |
tatccagaagttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||| ||||||||||||| ||||||||||| |||||||||| |||||| ||| ||||||| |
|
|
| T |
28019999 |
tatccacaagtcggcaaaatatcgaaattgttaggatggatgtcatgattggggttcgaactccggtacctccacttgtatgtatgagttt |
28019909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 212 - 284
Target Start/End: Complemental strand, 1582724 - 1582652
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1582724 |
tggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctctacttgtgtgtg |
1582652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 4227365 - 4227433
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4227365 |
cgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
4227433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 42557611 - 42557531
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| ||||||||||||| |||| |||||||||| |||| ||||||||||||| |
|
|
| T |
42557611 |
ttggcaaaatgccgaaattgttaggccggatgccatgatcggggtttgaactccggtacctccacttatgtgtgtgagttt |
42557531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 1323703 - 1323782
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||| | |||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
1323703 |
tggcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaacccaggtacctccacttgtgtgtgtgagttt |
1323782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 1573945 - 1573870
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
1573945 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtaagttt |
1573870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 8946452 - 8946527
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
8946452 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgcgtgtgtgagttt |
8946527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 14817451 - 14817526
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||| ||||| |||||||||||||||||||| |||||||| |||||||||| ||||||| |
|
|
| T |
14817451 |
aaaatgtcaaaattgttaggccggatgccatgatcggggttcgaaccctggtacctccacttgtgtgtatgagttt |
14817526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 15264447 - 15264522
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||| ||||| |||||||||||||||||||| |||||||| |||||||||| ||||||| |
|
|
| T |
15264447 |
aaaatgtcaaaattgttaggccggatgccatgatcggggttcgaaccctggtacctccacttgtgtgtatgagttt |
15264522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 18944944 - 18945023
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| |||| |||||| |||||||||||||| |||||||| |||| ||||||||||||| |
|
|
| T |
18944944 |
tggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccctggtacctccacttatgtgtgtgagttt |
18945023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 19306732 - 19306811
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||| ||||| |||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
19306732 |
tggcaaaatgccgaaattattaggccggatgccatgaccggggttcgaaccccggttcctccacttgtgtgtgtgagttt |
19306811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 33512817 - 33512896
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| || ||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
33512817 |
tggcaaaatgccgaaattgttaggccggatgctataatcggggtttgaaccccggtacctccacttgtgtgtgtgagttt |
33512896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 37410810 - 37410731
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
37410810 |
tggcaaaatgccgaaattgttaggccggatgtcatgactggggttcgaaccctgatacctccacttgtgtgtgtgagttt |
37410731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 40013288 - 40013363
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| || |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40013288 |
aaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacctccacttgtgtgtgtgagttt |
40013363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 40656212 - 40656137
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||| |||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40656212 |
aaaatgccgatattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
40656137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 40809065 - 40809144
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||| | |||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
40809065 |
tggcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccctggtacctccacttgtgtgtgtgagttt |
40809144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 43723332 - 43723411
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | ||||||||| || |||||||||||| ||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
43723332 |
tggcaaaatgccaaaattgttaagccggatgtcatgattggggttcgaaccccggttcctccacttgtgtgtgtgagttt |
43723411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 45041841 - 45041762
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | ||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45041841 |
tggcaaaatgccgaaattgttaggtcggatgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
45041762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 47086404 - 47086329
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||| | |||||| |||| ||||||||||||| |
|
|
| T |
47086404 |
aaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccctgttacctccacttatgtgtgtgagttt |
47086329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 48612537 - 48612616
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
48612537 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
48612616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 212 - 286
Target Start/End: Complemental strand, 2354905 - 2354831
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||| |||||||||||| |||||| ||||||||||||| |
|
|
| T |
2354905 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccccgatacctccacttgtgtgtgtg |
2354831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 214 - 284
Target Start/End: Original strand, 41780285 - 41780355
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||| || |||||||| |
|
|
| T |
41780285 |
gcaaaatgtcgaaattgttaggttggatgtcatgaccggggttcgaaccctggtacctccacgtgtgtgtg |
41780355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 219 - 291
Target Start/End: Original strand, 16862415 - 16862487
Alignment:
| Q |
219 |
atgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| | ||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
16862415 |
atgtcgaaattgttaggccggacgtcatgatcagagttcgaaccccggcacctccacttgtgtgtgtgagttt |
16862487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 216 - 284
Target Start/End: Complemental strand, 40857444 - 40857376
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
40857444 |
aaaatgtcgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacctccacttatgtgtg |
40857376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 46021535 - 46021459
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctcta-cttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
46021535 |
aaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccattttgtgtgtgtgagttt |
46021459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 1869840 - 1869915
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||| |||||||||| ||||| ||||| |||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
1869840 |
aaaatgccgatattgttaggccggatgccatgaccggggttcgaactccggtacctccacttgtgtgtgtgagttt |
1869915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 3043920 - 3043845
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| || |||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
3043920 |
aaaatgttgaaattgttaggccggatgtcatgattggagttcgaaccccgatacctccacttatgtgtgtgagttt |
3043845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 4674417 - 4674338
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||| | ||| |||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4674417 |
tggcaaaatgccgaaattgttaagtcagatatcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
4674338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 31717321 - 31717396
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| |||||||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
31717321 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttatgtgtgtgagttt |
31717396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 32251443 - 32251364
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||| | ||||||||||| |||||||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
32251443 |
tggcaaaatgccgaaattgttaagtcggatgtcatgaccggggttcgaaccccgatacctccacttatgtgtgtgagttt |
32251364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 33228724 - 33228799
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || ||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
33228724 |
aaaatgtcgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacatccacttgtgtgcgtgagttt |
33228799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 44327660 - 44327739
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| ||| |||||||||| |||||| |||||||||||||||||| |
|
|
| T |
44327660 |
tggcaaaatgtcaaaattgttaggccggatgtcatgaccggaattcgaaccccaatacctccacttgtgtgtgtgagttt |
44327739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 225 - 291
Target Start/End: Original strand, 6327244 - 6327310
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
6327244 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtacatccacttgtgtgtgtgagttt |
6327310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 212 - 286
Target Start/End: Complemental strand, 31300105 - 31300031
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||| ||||||||||| || ||||||||||| ||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
31300105 |
tggcaaaatgccgaaattgttaagccggatgtcatgaccggggttcgaacctcggtacctccacttatgtgtgtg |
31300031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 211 - 284
Target Start/End: Original strand, 41862806 - 41862879
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||| |||| |||||| |
|
|
| T |
41862806 |
ttggcaaaatgtcgaaattgttaggtcggatgtcataaccggggttcgaaccccggtaccttcacttatgtgtg |
41862879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 216 - 284
Target Start/End: Complemental strand, 5222677 - 5222609
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| ||||||||||| | |||||||||||||||||||||||||||| ||||||| |||||| |||| |
|
|
| T |
5222677 |
aaaatgccgaaattgttaagttggatgtcatgatcggggttcgaaccccagtacctccacttgtatgtg |
5222609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 28649463 - 28649395
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
28649463 |
cgaaattgttaggtcggatgtcatgatcgaagttcgaacctcggtacctccacttgtgtgtgtgagttt |
28649395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 216 - 284
Target Start/End: Original strand, 34708698 - 34708766
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| ||| |||||||||||||||| ||||| ||||||||||||||||||||||| |||| |||||| |
|
|
| T |
34708698 |
aaaatgccgatattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttatgtgtg |
34708766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 37117950 - 37117874
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||||||||||||||||| || |||| ||| |||||||||||||||||| |
|
|
| T |
37117950 |
caaaatgttgaaattgttaggtcggatgccatgatcggggttcgaatcctggtaactccacttgtgtgtgtgagttt |
37117874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 38930387 - 38930307
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||| |||||||||||||| |||||||||| |||||| |||| ||||||||| |||||||||||| ||||| |
|
|
| T |
38930387 |
ttggcaaagtgtcaaaattgttaggctgaatgtcatgattggggtttgaacttcggtacctccacttgtgtgtgtaagttt |
38930307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 4887621 - 4887542
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| || ||||||||||| | ||| || |||||||||||||||||| |
|
|
| T |
4887621 |
tggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccctgatacatccacttgtgtgtgtgagttt |
4887542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 6369552 - 6369626
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| ||||| ||||||| |||||| |||| ||||||||||||| |
|
|
| T |
6369552 |
aaaatgccgaaattgttaggccggatgtcatgatcgtggttc-aaccccgatacctccacttatgtgtgtgagttt |
6369626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 6378017 - 6378091
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| ||||| ||||||| |||||| |||| ||||||||||||| |
|
|
| T |
6378017 |
aaaatgccgaaattgttaggccggatgtcatgatcgtggttc-aaccccgatacctccacttatgtgtgtgagttt |
6378091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 29628488 - 29628413
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||| ||||| ||||| ||||||| ||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29628488 |
aaaatgccgaaattattaggtcggatgccatgatcagggttcgaatcccggtacctccacttgtgtgtgtgagttt |
29628413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 48467831 - 48467909
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| ||||||||||||| | |||||| |||| |||||||||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
48467831 |
tggcaaaatatcgaaattgttagaccggatgttatga-cggggttcgaaccctggtacctccacttgtgtgtgcgagttt |
48467909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 216 - 284
Target Start/End: Original strand, 40873210 - 40873279
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacct-ctacttgtgtgtg |
284 |
Q |
| |
|
|||||| ||||||| |||||||||||| ||||| |||||||||||||||||||||| | ||||||||||| |
|
|
| T |
40873210 |
aaaatgccgaaattattaggctggatgccatgaccggggttcgaaccccggtacctcccacttgtgtgtg |
40873279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 8059869 - 8059945
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| ||||||||||| || ||||||||||||||||||||||||||||||| || |||| ||||||||||| |
|
|
| T |
8059869 |
aaaatgtcaaaattgttaggtcgggcgtcatgatcggggttcgaaccccggtacctcaactttgtatgtgtgagttt |
8059945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 220 - 284
Target Start/End: Original strand, 8856305 - 8856369
Alignment:
| Q |
220 |
tgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
8856305 |
tgtcgaaattgttaggccggataccatgaccggagttcgaaccctggtacctctacttgtgtgtg |
8856369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 216 - 296
Target Start/End: Complemental strand, 9932282 - 9932202
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||| ||||||||||||| |||||| ||||||||| |||||||||| | ||| || |||| | |||||||||||||||| |
|
|
| T |
9932282 |
aaaatgccgaaattgttaggttggatgccatgatcggagttcgaaccctgatacttccacttatatgtgtgagttttataa |
9932202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 216 - 284
Target Start/End: Complemental strand, 23789517 - 23789449
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| ||| |||||||||| ||||| ||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
23789517 |
aaaatgccgatattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtg |
23789449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 28234945 - 28235025
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| ||| |||||||||| ||| ||||| | ||||||| ||||||| ||||||| |||||| ||||||||||| |
|
|
| T |
28234945 |
ttggcaaaatgccgatattgttaggccggacgtcataaccggggtttgaaccccagtacctccacttgtatgtgtgagttt |
28235025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 33628059 - 33628127
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| || ||||| ||||| | |||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
33628059 |
cgaaattgttaagccggatgccatgaccagggttcgaaccctggtacctccacttgtgtgtgtgagttt |
33628127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 35376969 - 35376889
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||| |||||||||||| ||||| ||||||||| |||| ||||| |||||||| | ||||||||| |||||| |
|
|
| T |
35376969 |
ttggcaaagtgtcaaaattgttaggccggatgccatgatcggagttcaaaccctggtacctccatttgtgtgtgagagttt |
35376889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 38678272 - 38678192
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| ||||| |||||| |||| ||||| ||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
38678272 |
ttggcaaaatgtagaaatagttaggtcagatgccatgaccggggtttgaaccccagtacctccacttgtgtgtgtgagttt |
38678192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 216 - 284
Target Start/End: Original strand, 46274972 - 46275040
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||| ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
46274972 |
aaaatgccgaaattgttaggtcggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtg |
46275040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 20182801 - 20182880
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||| | |||||| |||| ||||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
20182801 |
tggcaaaatgccgaaattgttacgtcggatgttatgactggggttcgaactccggtacctccactagtgtgtgtgagttt |
20182880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 22752938 - 22752863
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| |||||||||| |||| ||||| |||||||||||||||||||| ||||||| |||| ||||| ||||||| |
|
|
| T |
22752938 |
aaaatatcgaaattgtaaggccggatgctatgatcggggttcgaaccccagtacctccacttatgtgtatgagttt |
22752863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 37919989 - 37920068
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| |||||||||||||| |||| ||||| | || |||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
37919989 |
tggcaaaatatcgaaattgttaggtcagatgccatgacctggattcgaaccccggtacctccacttatgtgtgtgagttt |
37920068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 244 - 291
Target Start/End: Complemental strand, 40012065 - 40012018
Alignment:
| Q |
244 |
catgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40012065 |
catgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
40012018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 41708646 - 41708572
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||||||||||||||||||||| |||||| |||| ||| ||||||||| |
|
|
| T |
41708646 |
aaaatgtcaaaattgttaggtcggatgttatgatcggggttcgaaccccgatacctccactt-tgtatgtgagttt |
41708572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 283
Target Start/End: Complemental strand, 43416391 - 43416324
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
|||||| ||| |||||||||| |||| ||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
43416391 |
aaaatgccgatattgttaggccggataccatgaccggggttcgaaccccggtacctccacttgtgtgt |
43416324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 46715794 - 46715719
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||| ||||||||||||||| |||||| |||||| |||||||||| |
|
|
| T |
46715794 |
aaaatgtcgaaattgttaggcagaatgccatgaccggggttcgaaccccactacctccacttgtccgtgtgagttt |
46715719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 47182823 - 47182902
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||| | ||||| ||||||| ||||||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
47182823 |
tggcaaaatgccaaaattgttagaccggatgccatgatcagggttcgaaccccggtatctccatttgtgtgagtgagttt |
47182902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 225 - 291
Target Start/End: Original strand, 990248 - 990314
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||| |||||||| |||| ||| ||||||||| |
|
|
| T |
990248 |
aaattgttaggccggatgctatgatcggggttcgaaccctggtacctccacttatgtttgtgagttt |
990314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 33906305 - 33906382
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctcta--cttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| | |||||||||||| ||| ||||||| |||||||||||| |||||||||| | ||||||||||||||||| |
|
|
| T |
33906305 |
aaaatgccaaaattgttaggccggacgtcatgaccggggttcgaacaccggtacctccacgcttgtgtgtgtgagttt |
33906382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 211 - 284
Target Start/End: Complemental strand, 13769732 - 13769659
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||| |||||||||| ||| ||| ||||| |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
13769732 |
ttggcaaaatgccgaaattgttgggccggactccatgaccgggattcgaaccccggtacctccacttgtgtgtg |
13769659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 216 - 289
Target Start/End: Complemental strand, 19563199 - 19563126
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagt |
289 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||||||||||| |||| |||||| ||| |||| ||||||||||| |
|
|
| T |
19563199 |
aaaatgccgaaattgttaggtcggatgccatgatcggggtttgaactccggtatctccacttatgtgtgtgagt |
19563126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 2286198 - 2286122
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| | |||||||||||| ||||| ||||| | | |||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
2286198 |
caaaatgccaaaattgttaggccggatgccatgaccagagttcgaaccccgctacctccacttatgtgtgtgagttt |
2286122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 6384615 - 6384548
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||| | ||||| |||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
6384615 |
cgaaattgttaggccggacgccatga-cggggttcgaaccccggtgcctccacttatgtgtgtgagttt |
6384548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 12014829 - 12014761
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| || | | ||| |||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
12014829 |
cgaaattgttaggccagacgccttgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttt |
12014761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 12961928 - 12961852
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacc-tctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| ||| |||||||||| ||||||||| ||||||| || | |||||||||||||||| |
|
|
| T |
12961928 |
aaaatgtagaaattgttaggccggacatcatgatcggagttcgaacctcggtaccttcaatttgtgtgtgtgagttt |
12961852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 46911012 - 46910936
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| |||||| |||||||| | | ||||||||||||||||||||| ||||||||| || |||||||| ||||||| |
|
|
| T |
46911012 |
aaaatatcgaaactgttaggccgaacgtcatgatcggggttcgaacctcggtacctcaactttgtgtgtctgagttt |
46910936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 9234351 - 9234276
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||| | |||| ||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
9234351 |
aaaatgccgaaattgttaggccggacgctatgaccggagttcgaatcccggtatctccacttgtgtgtgtgagttt |
9234276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 10166894 - 10166968
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| | |||||||||| | |||||||| |||||||| ||||||||| |
|
|
| T |
10166894 |
aaaatgccgaaattgttaggccggatgccatga-ccgggttcgaactctggtacctccacttgtgtatgtgagttt |
10166968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 24829168 - 24829094
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||| || ||| || |||| ||||||||||||| |
|
|
| T |
24829168 |
aaaatgtcgaaattgttaggtcggatg-catgatcggggttcgaactccagtatcttcacttatgtgtgtgagttt |
24829094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 287
Target Start/End: Original strand, 32986127 - 32986198
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||| |||||||||||| |||| ||||||||| ||||||||| |
|
|
| T |
32986127 |
aaaatatcgaaattgttagggcggatgctatgattggggttcgaacctcggttcctctacttatgtgtgtga |
32986198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 250 - 291
Target Start/End: Complemental strand, 788928 - 788887
Alignment:
| Q |
250 |
cggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
788928 |
cggggttcgaaccccggtgcctccacttgtgtgtgtgagttt |
788887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 287
Target Start/End: Original strand, 10092696 - 10092769
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||| ||||||| |||||| ||||||||||| | ||||||||||| || ||| || | |||||||||||| |
|
|
| T |
10092696 |
gcaaaatgccgaaattattaggccggatgtcatgaccagggttcgaacctcgatacatccatttgtgtgtgtga |
10092769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 277
Target Start/End: Complemental strand, 12645402 - 12645341
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
||||||||||||||||||||| ||| || |||| || |||||||||||| ||||||| |||| |
|
|
| T |
12645402 |
aaaatgtcgaaattgttaggccggacgtaatgaccgaggttcgaacccctgtacctccactt |
12645341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 277
Target Start/End: Original strand, 24333365 - 24333426
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||| || ||||||| |||| |
|
|
| T |
24333365 |
aaaatgtcgaaattgttaggccgagcgtcatgatcggggttcgaactccagtacctccactt |
24333426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 288
Target Start/End: Original strand, 5523817 - 5523889
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgag |
288 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| ||||||||||| || | |||||| |||| || ||||||| |
|
|
| T |
5523817 |
aaaatgtcgaaattgttaggtcggatgccatgaccggggttcgaatcctgatacctccacttatgcgtgtgag |
5523889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 6328278 - 6328202
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||| |||||||||||||| |||||| || || ||||||||||||| |
|
|
| T |
6328278 |
aaaatgtcaaaattgttaggttggacgtcatgactagggttcgaaccccgatacctccactttatgtgtgtgagttt |
6328202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 9506946 - 9506870
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| || |||||||||||| ||| |||||| || ||||||||| |||||||||| || |||||||||||||||| |
|
|
| T |
9506946 |
aaaatatcaaaattgttaggccggacatcatgaccgaggttcgaactccggtacctccactttgtgtgtgtgagttt |
9506870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 284
Target Start/End: Complemental strand, 10084403 - 10084336
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| ||||||||||| || ||||| ||||| ||||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
10084403 |
aaaatgccgaaattgttaagccggatgccatgaccggggttcgaatccc-gtacctccacttgtgtgtg |
10084336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 24382622 - 24382690
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||||| ||| |||||| |||||||||| ||||||| |
|
|
| T |
24382622 |
cgaaattgttaggtcggatgctatgattggggttcgaactccgttacctccacttgtgtgtatgagttt |
24382690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 36254158 - 36254225
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| | ||| ||||| ||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
36254158 |
cgaaattgttaggccg-atgccatgactagggttcgaaccacggtacctccacttgtgtgtgtgagttt |
36254225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 38261024 - 38261100
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| || ||||| |||| | ||||| |||| ||||||||||||| |
|
|
| T |
38261024 |
caaaatgtcgaaattgttaggccggatgccatgaccgaggttctaacctggataccttcacttatgtgtgtgagttt |
38261100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 45946733 - 45946809
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| | ||||| |||||| ||||| ||| | || ||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
45946733 |
caaaatgccaaaattattaggccggatgccattactggagttcgaacctcggtacctccacttgtgtgtgtgagttt |
45946809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 45957438 - 45957362
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| | ||||||||| | ||| ||||||||| ||||||||||||||||||||| || |||||||||| ||||| |
|
|
| T |
45957438 |
aaaatgccaaaattgttaaaccggacgtcatgatcagggttcgaaccccggtacctccactttgtgtgtgttagttt |
45957362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 10703999 - 10703920
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| | | | | ||||| |||||||||| |||||||| |||| ||||||||||||| |
|
|
| T |
10703999 |
tggcaaaatgccgaaattgttaggccgtacgccttgatcaaggttcgaaccttggtacctccacttctgtgtgtgagttt |
10703920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 244 - 291
Target Start/End: Original strand, 40677070 - 40677117
Alignment:
| Q |
244 |
catgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| |||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
40677070 |
catgaccggggttcgaactctcgtacctctacttgtgtgtgtgagttt |
40677117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 46416569 - 46416648
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||| |||||||||| ||||| ||||| || ||||||| ||| |||||| |||| ||||||||||||| |
|
|
| T |
46416569 |
tggcaaaatgccgacattgttaggccggatgccatgaccgaaattcgaactccgatacctccacttatgtgtgtgagttt |
46416648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 287
Target Start/End: Complemental strand, 48401393 - 48401322
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||||| |||||||||||| ||||| |||||||||||||| | ||||||||| || |||||||||||| |
|
|
| T |
48401393 |
aaaatgttgaaattgttaggtcggatgctatgatcggggttcgtattccggtacctttatttgtgtgtgtga |
48401322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 287
Target Start/End: Complemental strand, 6071231 - 6071170
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||||| |||||| |||||| |||||||||| |||||| || |||||||||||||| |
|
|
| T |
6071231 |
aaattgttaggccggatgttatgatc-gggttcgaactccggtatcttcacttgtgtgtgtga |
6071170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 285
Target Start/End: Complemental strand, 27998994 - 27998932
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgt |
285 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| ||||||| | |||||||| | || ||||||| |
|
|
| T |
27998994 |
cgaaattgttagactggacgtcatgatcgggattcgaactctggtacctccatttttgtgtgt |
27998932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 43188554 - 43188624
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||| |||||||||||||| | ||| ||||| ||||||||||||| |||||| ||||||||||||| |
|
|
| T |
43188554 |
aaaatgccgaaattgttaggccgcatgccatgactagggttcgaaccccaatacctccacttgtgtgtgtg |
43188624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 270
Target Start/End: Original strand, 47459440 - 47459494
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacc |
270 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| ||| | |||||| |
|
|
| T |
47459440 |
aaaatgtcgaaattgttaggccggatgtcatgaccgaggttcaaactcaggtacc |
47459494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 273
Target Start/End: Complemental strand, 26336475 - 26336427
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctct |
273 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
26336475 |
gaaattgttaagctggatgtcatga-ccgggttcgaacccaggtacctct |
26336427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 286
Target Start/End: Original strand, 26794933 - 26795006
Alignment:
| Q |
213 |
ggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||||| | |||||||||| ||||| ||||| |||||||||||| |||||||||| |||| | |||||| |
|
|
| T |
26794933 |
ggcaaaatgccaaaattgttagatcggatgccatgaccggggttcgaactccggtacctccacttatatgtgtg |
26795006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 271
Target Start/End: Original strand, 41335675 - 41335708
Alignment:
| Q |
238 |
ggatgtcatgatcggggttcgaaccccggtacct |
271 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
41335675 |
ggatgtcatgatcggggttcgaactccggtacct |
41335708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 291
Target Start/End: Original strand, 45594846 - 45594899
Alignment:
| Q |
238 |
ggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
45594846 |
ggatgtcatgatcggggttcgaacatttgtaccttcacttgtgtgtgtgagttt |
45594899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 260
Target Start/End: Original strand, 6596562 - 6596610
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaa |
260 |
Q |
| |
|
|||||||||| | |||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
6596562 |
tggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaa |
6596610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 7264428 - 7264504
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||| ||| ||||| |||| || |||||||| | ||||||||| |||| ||||||||||||| |
|
|
| T |
7264428 |
caaaatgccgaaattgtgaggtcggatgctatgaccgaggttcgaatctcggtacctccacttatgtgtgtgagttt |
7264504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 141)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 42154246 - 42154162
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42154246 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa |
42154162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 24550833 - 24550912
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24550833 |
tggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
24550912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 37166158 - 37166237
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37166158 |
tggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
37166237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 579346 - 579271
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
579346 |
aaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttatgtgtgtgagttt |
579271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 5397048 - 5396969
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5397048 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
5396969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 30044692 - 30044613
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30044692 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
30044613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 34684222 - 34684301
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34684222 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
34684301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 34660899 - 34660815
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| | ||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34660899 |
tggcaaaatgcctaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa |
34660815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 9569495 - 9569574
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
9569495 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
9569574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 18813390 - 18813469
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18813390 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccgggcttcgaaccccggtacctccacttgtgtgtgtgagttt |
18813469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 24712108 - 24712187
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24712108 |
tggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
24712187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 29428075 - 29428154
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
29428075 |
tggcaaaataccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgagtgagttt |
29428154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 31436022 - 31435947
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31436022 |
aaaatgccgaaattgttaggccggatgtcatgattggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
31435947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 46488225 - 46488146
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
46488225 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcaaaccccggtacctccacttgtgtgtgtgagttt |
46488146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 47462144 - 47462065
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47462144 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
47462065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 49535905 - 49535984
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
49535905 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccagtacctctacttgtgtgtgtcagttt |
49535984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 217 - 291
Target Start/End: Complemental strand, 39284678 - 39284604
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39284678 |
aaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
39284604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 25586433 - 25586356
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
25586433 |
gcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttatgtgtgtgagttt |
25586356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 1052988 - 1052912
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||| |||||| ||||||||||| |
|
|
| T |
1052988 |
caaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccctggtacctccacttgtatgtgtgagttt |
1052912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 6487869 - 6487945
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| ||||||| ||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6487869 |
caaaatgccgaaattgttaggccggatgtcgtgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
6487945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 7944321 - 7944253
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7944321 |
cgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
7944253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 7512787 - 7512866
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7512787 |
tggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
7512866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 17846858 - 17846779
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
17846858 |
tggcaaaatgtcgaaattgttaggctggatcctatgatcgaggttcgaacctcggtacctccacttgtgtgtgtgagttt |
17846779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 29894430 - 29894509
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
29894430 |
tggcaaaatgtcgaaattattaggtcggatgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
29894509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 42856583 - 42856662
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
42856583 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaattccggtacctccacttgtgtgtgtgagttt |
42856662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 49882817 - 49882738
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| || |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49882817 |
tggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacctccacttgtgtgtgtgagttt |
49882738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 212 - 286
Target Start/End: Original strand, 35828294 - 35828368
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35828294 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
35828368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 36526247 - 36526170
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| | |||||||||||||| ||||| |||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36526247 |
gcaaaaagccgaaattgttaggccggatgccatgattggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36526170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 3848926 - 3848842
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||| ||||| |||||||||||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
3848926 |
tggcaaaatgccgaaattgctaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtaagttttataa |
3848842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 212 - 284
Target Start/End: Original strand, 12821185 - 12821257
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12821185 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtg |
12821257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 45725161 - 45725236
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| |||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
45725161 |
caaaatgccgaaattgttaggc-ggatgtcatgatcgaggttcgaacctcggtacctttacttgtgtgtgtgagttt |
45725236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 49319754 - 49319830
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| |||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
49319754 |
caaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccgcttgtgtgtgtgagttt |
49319830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 1083528 - 1083607
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||| ||||| |
|
|
| T |
1083528 |
tggcaaaatgccgaaattgttaggtcagatgtcatgatcggggttcgaaccccgatacctccacttgtgtgtgtaagttt |
1083607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 3084350 - 3084271
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||||||||||||||| |||| |||||| |||||||||||||||||| |
|
|
| T |
3084350 |
tggcaaaatgccgaaattgttaggtcggatgccatgatcggggttcgaatcccgatacctccacttgtgtgtgtgagttt |
3084271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 13389040 - 13389119
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
13389040 |
tggcaaaatgctgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
13389119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 13632114 - 13632189
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
13632114 |
aaaatgtcgaaattgttaggccggatgccatgaccgaggttcgaaccccagtacctccacttgtgtgtgtgagttt |
13632189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 23974750 - 23974671
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| |||| |||||| ||| |||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
23974750 |
tggcaaaatgccgaaattgttaggccggatatcatgaccggtgttcgaaccctggtacctccacttgtgtgtgtgagttt |
23974671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 28010159 - 28010080
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||| |||| |||||| ||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
28010159 |
tggcaaaatgccaaaattgttaggcaggatatcatgaccggggttcgaaccccggtaactccacttgtgtgtgtgagttt |
28010080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 31263609 - 31263530
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||| |||| | ||||| ||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
31263609 |
tggcaaaatgtcgaaattattagaccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
31263530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 33416688 - 33416609
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| |||||||||||| | ||||||||||||| |||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
33416688 |
tggcaaaataccgaaattgttagaccggatgtcatgatcagggttcgaaccctggtacctccacttgtgtgtgtgagttt |
33416609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 39997877 - 39997802
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| |||| ||||| ||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
39997877 |
aaaatgtcgaaattgttaggccggataccatgaccggggttcgaacctcggtacctccacttgtgtgtgtgagttt |
39997802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 42412096 - 42412017
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| |||| ||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
42412096 |
tggcaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
42412017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 50779899 - 50779820
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
50779899 |
tggcaaaatgccgaaattgttaggccggatgccatgaccgggattcgaaccccggttcctccacttgtgtgtgtgagttt |
50779820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 214 - 291
Target Start/End: Original strand, 29648786 - 29648863
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||| ||||||||| ||||||||||| | |||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
29648786 |
gcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccctggtacctccacttgtgtgtgtgagttt |
29648863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 214 - 291
Target Start/End: Original strand, 54864418 - 54864495
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||||||||| ||||| ||||||||| |||||||||||||||||| |
|
|
| T |
54864418 |
gcaaaatgtcaaaattgttaggtcggatgccatgatcggggtttgaacctcggtacctcaacttgtgtgtgtgagttt |
54864495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 3037260 - 3037336
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| |||||||||||| |||| ||||| |||| ||||||||||||| |
|
|
| T |
3037260 |
caaaatgccgaaattattaggctggatgtcatgaccggggttcgaactccggcacctccacttatgtgtgtgagttt |
3037336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 14285118 - 14285194
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| | |||||||||||| ||||| ||||| ||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14285118 |
caaaatgccaaaattgttaggccggatgccatgaccggcgttcgaaccccggtacctccacttgtgtgtgtgagttt |
14285194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 17358069 - 17358145
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||| | ||||||||||||||||||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
17358069 |
caaaatgctgaaattgttagaccggatgtcatgatcggggttcgaaccccagtatctccacttgtgtgtgtgagttt |
17358145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 31375136 - 31375212
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||| |||||| |||| ||||| ||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
31375136 |
caaaatgtcgaaattattaggccagatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtaagttt |
31375212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 35615908 - 35615984
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||| || |||||||| |||| ||||||||||||| |
|
|
| T |
35615908 |
caaaatgtcgaaattgttaggccagatgtcatgaccggggttcgaatcctggtacctccacttatgtgtgtgagttt |
35615984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 51675772 - 51675696
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| || |||||||||||| |||| |||||| |||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
51675772 |
caaaatatctaaattgttaggccggatatcatgaccggggttcgaactccggtacctccacttgtgtgtgtgagttt |
51675696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 8810873 - 8810798
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||||| ||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8810873 |
aaaatgccgaaattattaggtcggatgtcatgaccggagttcgaaccccggtacctcaacttgtgtgtgtgagttt |
8810798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 287
Target Start/End: Original strand, 24407517 - 24407592
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| |||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
24407517 |
tggcaaaatgtcgaaattgttaggtcggatgccatgaccgggattcgaaccccggtaccttcacttgtgtgtgtga |
24407592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 28033216 - 28033291
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
28033216 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccagtatctccacttgtgtgtgtgagttt |
28033291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 28983752 - 28983831
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| ||||| |||||||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
28983752 |
tggcaaaatgtcgacattgttaggtcggatgccatgaccggggttcgaactccggtacctccacttatgtgtgtgagttt |
28983831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 32104118 - 32104039
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||| ||| |||| || |||||||||||||||||| |
|
|
| T |
32104118 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccagtacttccacttgtgtgtgtgagttt |
32104039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 35352194 - 35352119
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| |||| | ||||| |||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
35352194 |
aaaatgtcgaaattgttaggtcggatattatgatgggggtttgaaccccggtacctctacttgtgtgtctgagttt |
35352119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 36860953 - 36860878
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||| |||||||||| ||||||||| | |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36860953 |
aaaatgccgatattgttaggccggatgtcataactggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36860878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 37050721 - 37050800
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||||| || ||| |||| ||||||||||||| |
|
|
| T |
37050721 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccgatagctccacttatgtgtgtgagttt |
37050800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 42116505 - 42116579
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||| ||||| ||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
42116505 |
aaaatgtcgaaatttttaggtcggatgccatgatcggggttcgaaccccggta-ctccacttgtgtgtgtgagttt |
42116579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 287
Target Start/End: Original strand, 46552949 - 46553020
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||| | |||||||||||| ||||||||||| ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
46552949 |
aaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtga |
46553020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 225 - 291
Target Start/End: Complemental strand, 16971777 - 16971711
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| |||||| |||| |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
16971777 |
aaattgttaggccggatgttatgaccggggttcgaaccccgctacctccacttgtgtgtgtgagttt |
16971711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 212 - 286
Target Start/End: Original strand, 51281486 - 51281560
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||| |||||||||||| |||||| ||||||||||||| |
|
|
| T |
51281486 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggagttcgaaccccgatacctccacttgtgtgtgtg |
51281560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 238 - 291
Target Start/End: Complemental strand, 16477019 - 16476966
Alignment:
| Q |
238 |
ggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16477019 |
ggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
16476966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 213 - 286
Target Start/End: Complemental strand, 25699047 - 25698974
Alignment:
| Q |
213 |
ggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||||||||||||| |||||| ||||| ||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
25699047 |
ggcaaaatgtcgaaattattaggccggatgccatgatcggagttcgaacagcggtacctccacttgtgtgtgtg |
25698974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 46194269 - 46194351
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||| |||||||||| |||||| ||| ||| |||||||||||||||||| |
|
|
| T |
46194269 |
tggcaaaatgtcaaaattgttaggtcggatgtcatgatcagggttcgaactccggtaactccact--tgtgtgtgagttttataa |
46194351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 36752382 - 36752458
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||| |||| | | ||||||||| |
|
|
| T |
36752382 |
caaaatgccgaaattgttaggccagatgtcatgatcggggttcgaaccccgatacctccacttatatatgtgagttt |
36752458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 216 - 272
Target Start/End: Original strand, 38882742 - 38882798
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctc |
272 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
38882742 |
aaaatgtcgaaattgttaggctggacgtcatgaccggagttcgaaccccggtacctc |
38882798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 1982581 - 1982660
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| | ||||||||| |||||||| ||||| |||| || |||||||||||||||||| |
|
|
| T |
1982581 |
tggcaaaatgccgaaattgttaggccgtatgtcatgaccggggttcaaaccctggtaaatccacttgtgtgtgtgagttt |
1982660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 283
Target Start/End: Complemental strand, 11311630 - 11311564
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
11311630 |
aaaatgccgaaattgttaggccggatgtcatga-cggggttcgaactccggtacctccacttgtgtgt |
11311564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 11673313 - 11673391
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| |||||||||||||| ||||| ||||||||||||||||||||| ||||||| |||| ||||||| ||||| |
|
|
| T |
11673313 |
tggcaaaataccgaaattgttaggcaggatgccatgatcggggttcgaacccc-gtacctccacttatgtgtgtaagttt |
11673391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 12316034 - 12315959
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||| | |||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
12316034 |
aaaatgtcgaaatagttaggccagatgccatgaccagggttcgaaccccgatacctccacttgtgtgtgtgagttt |
12315959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 13218221 - 13218296
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||||||||||||||||| |||| || |||||| ||||||||||| |
|
|
| T |
13218221 |
aaaatgtcaaaattgttaggtcggatgccatgatcggggttcgaaccccagtacttccacttgtatgtgtgagttt |
13218296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 18371366 - 18371445
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| | || |||||| |||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
18371366 |
tggcaaaatgccgaaattgttaggccgaatatcatgactggggtttgaaccccggtacctccacttatgtgtgtgagttt |
18371445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 29334515 - 29334594
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| ||| |||| |||||||||||||| | |||||||||||||||| |
|
|
| T |
29334515 |
tggcaaaataccgaaattgttaggtcggatgtcatgaccggagttcaaaccccggtacctccatttgtgtgtgtgagttt |
29334594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 31583706 - 31583632
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||| |||| ||||| ||||| |||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
31583706 |
aaaatgtcgaaattgt-aggcccgatgttatgattggggttcgaaccccggtacctccacttatgtgtgtgagttt |
31583632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 35318560 - 35318639
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| |||| |||||| ||||||||||| || ||||||| ||||||| |||||||||| |
|
|
| T |
35318560 |
tggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaatcctggtaccttcacttgtgcgtgtgagttt |
35318639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 228 - 291
Target Start/End: Original strand, 38814619 - 38814682
Alignment:
| Q |
228 |
ttgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
38814619 |
ttgttaggttggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
38814682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 271
Target Start/End: Complemental strand, 40610726 - 40610671
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacct |
271 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
40610726 |
aaaatgtcgaaattgttaggctggacgtcatgatcggagttcgaacctcggtacct |
40610671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 287
Target Start/End: Complemental strand, 52556491 - 52556417
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||| | |||||||||||| ||||| |||||||||||||||||||||| | |||| |||||||||||||| |
|
|
| T |
52556491 |
tggcaaaatgccaaaattgttaggccggatgccatgatcggggttcgaaccccgat-cctccacttgtgtgtgtga |
52556417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 54097048 - 54096969
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||| |||| ||||||||||| || ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54097048 |
tggcaaaatgccgaaattattagatcggatgtcatgaccgacgttcgaaccccggtacctccacttgtgtgtgtgagttt |
54096969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 216 - 286
Target Start/End: Complemental strand, 28187268 - 28187198
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||| || ||||||| |||| |||||||| |
|
|
| T |
28187268 |
aaaatgtcgaaattgttaggccggatgctatgatcggggttcgaactccagtacctccacttatgtgtgtg |
28187198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 212 - 277
Target Start/End: Complemental strand, 5880394 - 5880329
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
||||||||||||||||||||||| | ||||| ||||| |||||||||||||||| |||||| |||| |
|
|
| T |
5880394 |
tggcaaaatgtcgaaattgttagaccggatgccatgaccggggttcgaaccccgatacctccactt |
5880329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 9038312 - 9038235
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||| | | ||||||||||| ||| ||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
9038312 |
gcaaaatgccgaaattgtttgaccggatgtcatgaccggagtttgaatcccggtacctccacttgtgtgtgtgagttt |
9038235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 218 - 291
Target Start/End: Complemental strand, 11371162 - 11371089
Alignment:
| Q |
218 |
aatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||| |||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
11371162 |
aatgccgaaattgttaggctagataccatgacaggggttcgaaccccggtacctccacttgtatgtgtgagttt |
11371089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 216 - 285
Target Start/End: Original strand, 30922503 - 30922572
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgt |
285 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| || |||||||||||| |||||| |||||||||||| |
|
|
| T |
30922503 |
aaaatgtcgaaattgttatgccgaatgtcatgataggagttcgaaccccgatacctccacttgtgtgtgt |
30922572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 239 - 288
Target Start/End: Original strand, 37913352 - 37913401
Alignment:
| Q |
239 |
gatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgag |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
37913352 |
gatgtcatgatcggggttcgaaccccggtacctccacttatgtgtgtgag |
37913401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 215 - 284
Target Start/End: Complemental strand, 52303201 - 52303132
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||| |||||| |||| |
|
|
| T |
52303201 |
caaaatgctgaaattgttaggctggatgctatgatcggggttcgaatcccggtacctccacttgtatgtg |
52303132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 939610 - 939686
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||| | ||| |||| ||||||||||||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
939610 |
caaaatgtcgaaatcgttagacatgatatcataatcggggttcgaaccacggtacctccacttatgtgtgtgagttt |
939686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 212 - 284
Target Start/End: Complemental strand, 1033557 - 1033485
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||| |||||| ||||||||||| |
|
|
| T |
1033557 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctaatacctccacttgtgtgtg |
1033485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 243 - 291
Target Start/End: Complemental strand, 5333283 - 5333235
Alignment:
| Q |
243 |
tcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5333283 |
tcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
5333235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 211 - 271
Target Start/End: Original strand, 36608020 - 36608079
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacct |
271 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
36608020 |
ttggcaaaatgtcgaaattgttag-ctggacgccatgatcggggttcgaactccggtacct |
36608079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 290
Target Start/End: Original strand, 2573953 - 2574028
Alignment:
| Q |
216 |
aaaatgtcgaaatt-gttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtt |
290 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| ||||||| ||||||| || |||||||| |||||||| |
|
|
| T |
2573953 |
aaaatgtcgaaatttgttaggtcggatgtcatgatcgggattcgaactccggtacatccacttgtgtatgtgagtt |
2574028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 8017874 - 8017949
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| |||||| |||| ||||||| |||| ||| |||||| |||| ||||||||||||| |
|
|
| T |
8017874 |
aaaatgttgaaattgttaggccggatgttatgaccggggttagaactccgatacctccacttttgtgtgtgagttt |
8017949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 25726619 - 25726694
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| | ||| |||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
25726619 |
aaaatgacgaaattgttaggcagaatgccatgatcggggttcgaacttaagtacctccacttgtgtgtgtgagttt |
25726694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 287
Target Start/End: Original strand, 26440987 - 26441062
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||| | |||||| ||||| | |||||| |||||||||||||| |
|
|
| T |
26440987 |
tggcaaaatgccgaaattgttaggccgggtgtcatgaccagggttccaaccctgatacctccacttgtgtgtgtga |
26441062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 32233636 - 32233711
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||| || |||| | |||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
32233636 |
aaaatgccgaaattgttatgccggatattatgaatggggtttgaaccccggtacctccacttgtgtgtgtgagttt |
32233711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 35463910 - 35463836
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||| | |||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
35463910 |
aaaatgccaaaattgttaggttggatgtcatgactgtggttcgaaccccggtacctccactt-tgtgtgtgagttt |
35463836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 287
Target Start/End: Complemental strand, 39301378 - 39301303
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||||| || |||| ||||||||| |||| |||||| | |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39301378 |
tggcaaactgccgaatttgttaggccggatatcatgaccagggttcgaaccctggtacctccacttgtgtgtgtga |
39301303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 41323558 - 41323633
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
41323558 |
aaaatgtcgaaattgttagatcggatgctatgattggggttcgaaccccggtaccttcacttctgtgtgtgagttt |
41323633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 284
Target Start/End: Original strand, 21378319 - 21378380
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||||||| |||||||||| |||| |||||| |
|
|
| T |
21378319 |
cgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttatgtgtg |
21378380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 212 - 269
Target Start/End: Complemental strand, 54908000 - 54907943
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtac |
269 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||||| |||| |||||||||||| |
|
|
| T |
54908000 |
tggcaaaatgccgaaattgttaggccggatgccatgatcgaggtttgaaccccggtac |
54907943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 284
Target Start/End: Complemental strand, 5060514 - 5060446
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||||||||| | |||| |||||||||| |||||||||||| ||||| |||| |||||| |
|
|
| T |
5060514 |
aaaatgtcgaaattgttagtccggatatcatgatcggcgttcgaaccccgataccttcacttatgtgtg |
5060446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 224 - 291
Target Start/End: Complemental strand, 9064885 - 9064817
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggta-cctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| | ||| ||| ||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
9064885 |
gaaattgttaggtcgaatgccataatcggggttcgaaccccggtaccctccacttgtgtgtgtgagttt |
9064817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 17271322 - 17271398
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| ||| ||||| |||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
17271322 |
caaaatgccgaaattgttaggccaaatgccatgactggggtttgaaccccggtacctccacttatgtgtgtgagttt |
17271398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 33530243 - 33530319
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| ||| ||||||| || ||||| |||| | |||||||||| |||||||||||||||| |
|
|
| T |
33530243 |
aaaatgttgaaattgttaggccggacgtcatgaccgaggttcaaacctcagtacctctactttgtgtgtgtgagttt |
33530319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 268
Target Start/End: Original strand, 47384222 - 47384274
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggta |
268 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
47384222 |
aaaatgtcggaattgttaggccggatgtcatgaccagggttcgaaccccggta |
47384274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 48391713 - 48391789
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctcta-cttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| || |||||||||||||||| ||||||| |||||||||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
48391713 |
aaaatatcaaaattgttaggctggacgtcatgactggggttcgaaccccagtacctctattttgtatgtgtgagttt |
48391789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 220 - 291
Target Start/End: Complemental strand, 2942535 - 2942464
Alignment:
| Q |
220 |
tgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||| ||||||||||| |||||| ||||| | |||||||||| |
|
|
| T |
2942535 |
tgtcaaaattgttaggtcggatgccatgatcgggattcgaaccccgatacctccacttgcgcgtgtgagttt |
2942464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 9747369 - 9747294
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||| | |||| ||||||||||||||||||| | |||||| |||||| ||||||||||| |
|
|
| T |
9747369 |
aaaatgtcgaaattgttatgtcagatgccatgatcggggttcgaaccttgatacctccacttgtatgtgtgagttt |
9747294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 17480956 - 17481031
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| | |||||||||||| | ||| ||||||| |||||||||||||||||| || |||| ||| ||||||||| |
|
|
| T |
17480956 |
aaaatgccaaaattgttaggccgaatgccatgatcagggttcgaaccccggtacttccacttatgtatgtgagttt |
17481031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 17518577 - 17518502
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| | ||||||||| || ||||| |||||||||||||| ||||| |||||||| | || ||||||||||||| |
|
|
| T |
17518577 |
aaaatgccaaaattgttacgccggatgccatgatcggggttcaaaccctggtacctccatttatgtgtgtgagttt |
17518502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 38173478 - 38173399
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| |||| ||||||||||||| |||||| |||| || ||||||| |||||| |||| |||||||||||||||||| |
|
|
| T |
38173478 |
tggcagaatgccgaaattgttaggtcggatgttgtgattggagttcgaatcccggtgcctccacttgtgtgtgtgagttt |
38173399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 287
Target Start/End: Original strand, 43588798 - 43588860
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||| || || |||||||||||||| |
|
|
| T |
43588798 |
gaaattgttaggccggatgtcatgatc-gggttcgaaccccgatatcttcacttgtgtgtgtga |
43588860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 51564499 - 51564420
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||| |||||||| ||| | ||||| | ||||||||||||||| ||||| |||| || |||||||||| |
|
|
| T |
51564499 |
tggcaaaatgccgaaactgttaggccggacgccatgaccagggttcgaaccccggcacctccacttatgcgtgtgagttt |
51564420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 216 - 282
Target Start/End: Complemental strand, 9749186 - 9749120
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtg |
282 |
Q |
| |
|
|||||| ||||||||||| || ||||| |||||||||| ||||||||| | ||||||||| |||||| |
|
|
| T |
9749186 |
aaaatgccgaaattgttatgccggatgccatgatcgggattcgaaccctgatacctctacgtgtgtg |
9749120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 215 - 284
Target Start/End: Original strand, 4379330 - 4379399
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||| ||| ||||||| |||| ||| || ||||||||||| |
|
|
| T |
4379330 |
caaaatgccgaaattgttaggccggatgccatgaccggagttcgaatcccgatacatcaacttgtgtgtg |
4379399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 277
Target Start/End: Complemental strand, 9696396 - 9696335
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
|||||||||||||||||||| | | || |||||||||||||||||| ||||||||| |||| |
|
|
| T |
9696396 |
aaaatgtcgaaattgttaggtcgaacgttatgatcggggttcgaacctcggtacctccactt |
9696335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 293
Target Start/End: Original strand, 21509095 - 21509172
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtttta |
293 |
Q |
| |
|
|||| ||||| ||||||||| |||| ||||||||| |||||| ||| | || ||||| |||||||||||||| ||||| |
|
|
| T |
21509095 |
aaaaagtcgatattgttaggttggacgtcatgatcagggttcaaacactggcacctccacttgtgtgtgtgattttta |
21509172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 212 - 261
Target Start/End: Complemental strand, 53398396 - 53398347
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaac |
261 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
53398396 |
tggcaaaatgttgaaattgttaggctgaatgtcatgaccggagttcgaac |
53398347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 255 - 296
Target Start/End: Original strand, 55214538 - 55214579
Alignment:
| Q |
255 |
ttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55214538 |
ttcgaatcccggtacctccacttgtgtgtgtgagttttataa |
55214579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 13849380 - 13849456
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| || ||| |||||||||||||||||||| ||||| || ||||||||| |||||| |
|
|
| T |
13849380 |
aaaatgtcgaaattgttaggtcagacgtcttgatcggggttcgaaccccgacacctccactttgtgtgtgggagttt |
13849456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 16460959 - 16461034
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| || ||||||||||| ||| |||||||||||| ||||||||||| |||| |||||||||||||||||| |
|
|
| T |
16460959 |
caaaatatcaaaattgttaggtcggacgtcatgatcggg-ttcgaaccccgacaccttcacttgtgtgtgtgagttt |
16461034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 287
Target Start/End: Complemental strand, 26186241 - 26186170
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtga |
287 |
Q |
| |
|
||||||||||||||||||||| || |||||||| |||| |||||||||||||| || || |||||||||||| |
|
|
| T |
26186241 |
aaaatgtcgaaattgttaggccagacgtcatgattgggg-tcgaaccccggtacttccactttgtgtgtgtga |
26186170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 28758401 - 28758477
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||| ||||| ||| ||||||| ||| ||||||||||| ||||||| || |||||||||||||||| |
|
|
| T |
28758401 |
aaaatgccgaaattattaggtcggacgtcatgaccggagttcgaaccccagtacctccactttgtgtgtgtgagttt |
28758477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 37340211 - 37340136
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||| |||||||||| ||||| ||| || |||||||||||||||| |
|
|
| T |
37340211 |
aaaatgtcgaaattgttaggccgaacgtcatgatc-aggttcgaaccacggtatctccactttgtgtgtgtgagttt |
37340136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 284
Target Start/End: Original strand, 43002564 - 43002632
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| |||||||| ||||| ||||||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
43002564 |
aaaatgccgaaattgctaggccatatgtcatgatcggggttcgaacctcgataccttcacttgtgtgtg |
43002632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 52772135 - 52772215
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| |||||| | ||||||||||| ||||| | ||||||||||||||| |||| ||||| |||||||||||| ||||| |
|
|
| T |
52772135 |
ttggtaaaatgccaaaattgttaggtcggatgccttgatcggggttcgaatcccgataccttcacttgtgtgtgtaagttt |
52772215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 3780338 - 3780413
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| || ||||||| | ||||||||| |||||||||| |||||| ||||| ||||| |
|
|
| T |
3780338 |
aaaatgccgaaattgttaggccagacgtcatgactgaggttcgaactccggtacctccacttgtatgtgtaagttt |
3780413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 17815250 - 17815172
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| | | ||||||| | | ||||||||||| ||||||| | |||||||||||||||| |
|
|
| T |
17815250 |
tggcaaaatgccgaaattgttaggtcgaacgtcatga-ctgagttcgaaccccagtacctccatttgtgtgtgtgagttt |
17815172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 271
Target Start/End: Original strand, 21172903 - 21172958
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacct |
271 |
Q |
| |
|
|||||| ||||||||||| | |||||| ||||| ||||||||||||||||||||| |
|
|
| T |
21172903 |
aaaatgccgaaattgttaaaccggatgttatgattggggttcgaaccccggtacct |
21172958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 291
Target Start/End: Complemental strand, 48628559 - 48628493
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
48628559 |
aaattgttagattggatgccatgactggggttcgaaccccggtatcttcatttgtgtgtgtgagttt |
48628493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 289
Target Start/End: Complemental strand, 19392240 - 19392167
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagt |
289 |
Q |
| |
|
|||||| |||||||| ||||| ||| | ||| ||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
19392240 |
aaaatgccgaaattgctaggccggacaccgtgaccggggttcgaaccccggctcctccacttgtgtgtgtgagt |
19392167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 277
Target Start/End: Original strand, 22717122 - 22717183
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
|||||||||||||||||||| | | |||||||| | |||||||||||| ||||||||||| |
|
|
| T |
22717122 |
aaaatgtcgaaattgttaggtcgaacgtcatgattagagttcgaaccccgatacctctactt |
22717183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 277
Target Start/End: Original strand, 24870621 - 24870682
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
|||||| |||||||||||||| ||| || |||| || |||||||||| ||||||||| |||| |
|
|
| T |
24870621 |
aaaatgccgaaattgttaggccggacgtaatgaccgaggttcgaacctcggtacctccactt |
24870682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 291
Target Start/End: Original strand, 25003798 - 25003831
Alignment:
| Q |
258 |
gaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
25003798 |
gaaccccggtacctccacttgtgtgtgtgagttt |
25003831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 277
Target Start/End: Complemental strand, 31010049 - 31009988
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| || ||||||| | |||||||| |||| |
|
|
| T |
31010049 |
aaaatgccgaaattgttaggctaaatgtcatgatcaggtttcgaactcaggtacctccactt |
31009988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 46343360 - 46343409
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctc |
272 |
Q |
| |
|
|||||||||||||| ||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
46343360 |
cgaaattgttaggccggacgtcatgaccggggttcgaaccctagtacctc |
46343409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 227 - 291
Target Start/End: Original strand, 7413127 - 7413191
Alignment:
| Q |
227 |
attgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| | ||||| ||| | ||||||||||| ||||||||||| |||| | ||||||||||| |
|
|
| T |
7413127 |
attgttagaccggatgccataaccggggttcgaatcccggtacctccacttatatgtgtgagttt |
7413191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 227 - 291
Target Start/End: Original strand, 7459207 - 7459271
Alignment:
| Q |
227 |
attgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| | ||||| ||| | ||||||||||| ||||||||||| |||| | ||||||||||| |
|
|
| T |
7459207 |
attgttagaccggatgccataaccggggttcgaatcccggtacctccacttatatgtgtgagttt |
7459271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 262
Target Start/End: Original strand, 51425352 - 51425400
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaacc |
262 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| | ||||| ||||| |
|
|
| T |
51425352 |
gcaaaatgccgaaattgttaggccggatgtcatgaacagggtttgaacc |
51425400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 69; Significance: 5e-31; HSPs: 116)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 23080206 - 23080122
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23080206 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa |
23080122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 212 - 292
Target Start/End: Original strand, 23957072 - 23957152
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtttt |
292 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
23957072 |
tggcaaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttt |
23957152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 43035459 - 43035539
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43035459 |
ttggcaaaataccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
43035539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 15897234 - 15897313
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15897234 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
15897313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 20251593 - 20251514
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20251593 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
20251514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 35476598 - 35476519
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35476598 |
tggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
35476519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 45049405 - 45049484
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
45049405 |
tggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggtacctccacttgtgtgtgtgagttt |
45049484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 214 - 292
Target Start/End: Original strand, 3048564 - 3048642
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtttt |
292 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
3048564 |
gcaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttt |
3048642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 214 - 291
Target Start/End: Original strand, 24381267 - 24381344
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24381267 |
gcaaaatgtcgaaattgttaggctggatgccatgaccggggttcgaaccccggtacctccgcttgtgtgtgtgagttt |
24381344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 18368814 - 18368898
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
18368814 |
tggcaaaatgccgaaattgttaggtcggatatcatgatcggggttcgaaccccggtacctccacttgtgtgtctgagttttataa |
18368898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 32023272 - 32023356
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
32023272 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttttataa |
32023356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 38490508 - 38490424
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38490508 |
tggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa |
38490424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 13268083 - 13268004
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13268083 |
tggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
13268004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 34667064 - 34667143
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34667064 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtgagttt |
34667143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 42200970 - 42200891
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
42200970 |
tggcaaaatgccaaaattgttaggccggatgtcatgatcggggttcgaacctcggtacctccacttgtgtgtgtgagttt |
42200891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 43461438 - 43461363
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43461438 |
aaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
43461363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 217 - 291
Target Start/End: Complemental strand, 36685506 - 36685432
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
36685506 |
aaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccctgatacctccacttgtgtgtgtgagttt |
36685432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 214 - 291
Target Start/End: Original strand, 6731564 - 6731641
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| |||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
6731564 |
gcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacatccacttgtgtgtgtgagttt |
6731641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 8859393 - 8859316
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||| |||||||||||| ||||| |
|
|
| T |
8859393 |
gcaaaatgtcgaaattgttaggccggatgtcatgattggggttcgaaccccgatacctccacttgtgtgtgtcagttt |
8859316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 4014918 - 4014842
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| |||| |||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4014918 |
caaaatgccgaaattgttaggccggatctcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
4014842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 216 - 296
Target Start/End: Original strand, 39218705 - 39218785
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||| ||||||||||||| |||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
39218705 |
aaaatgccgaaattgttaggtcggatgttatgatcggggttcgaaccccggtacctccacttgtatgtgtgagttttataa |
39218785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 2287417 - 2287338
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| |||| |||||| ||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
2287417 |
tggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccccggtacctccacttgtgtgtgggagttt |
2287338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 15920722 - 15920643
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||||||| |||||||| |||||||||| ||||||| |
|
|
| T |
15920722 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaacccaggtacctccacttgtgtgtatgagttt |
15920643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 16010721 - 16010642
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| || |||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16010721 |
tggcaaaatgtcgaaattgttaagccggatactatgatcggggttcgaaccccggtacctcaacttgtgtgtgtgagttt |
16010642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 16535047 - 16534972
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
16535047 |
aaaatgtcgaaattgttaggccggatgtcatgatcggagttcgaaccccggtaactccacttgggtgtgtgagttt |
16534972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 23497616 - 23497541
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||||| ||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23497616 |
aaaatgccgaaattgttaggccggatgtcgtgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
23497541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 34481779 - 34481700
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34481779 |
tggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggtaccctcacttgtgtgtgtgagttt |
34481700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 36754849 - 36754770
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36754849 |
tggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36754770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 37644337 - 37644262
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||| |||||| |||||||||||| ||||| |
|
|
| T |
37644337 |
aaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccccgatacctccacttgtgtgtgtaagttt |
37644262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 39070043 - 39070118
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39070043 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
39070118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 41164756 - 41164677
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||||||| |||| |||||| ||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
41164756 |
tggcaaagtgtcgaaattgttaggccggatatcatgaccggggttcgaaccccagtacctctacttatgtgtgtgagttt |
41164677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 216 - 290
Target Start/End: Complemental strand, 34242555 - 34242481
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtt |
290 |
Q |
| |
|
|||||| |||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
34242555 |
aaaatgccgaaattgttaggccggatatcatgatcggggttcgaaccccggtacctccacttgtgtgcgtgagtt |
34242481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 212 - 286
Target Start/End: Complemental strand, 42160365 - 42160291
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||| |||| |
|
|
| T |
42160365 |
tggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttatgtatgtg |
42160291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 214 - 291
Target Start/End: Original strand, 39310388 - 39310465
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||||| |||||| ||||||||||||||||| |||||| ||| |||||||||||||||||| |
|
|
| T |
39310388 |
gcaaaatatcgaaattgttaggccggatgttatgatcggggttcgaactccggtaactccacttgtgtgtgtgagttt |
39310465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 727394 - 727318
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
727394 |
caaaatgccgaaattgttaggtcggatgccatgatcggggttcgaactccggtacctccacttgtgtgtgtgagttt |
727318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 32517922 - 32517846
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || |||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
32517922 |
aaaatgtcgaaattgttaggctggacgtcatgaccgaggttcgaaccccggtacctccactttgtgtgtgtgagttt |
32517846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 37198836 - 37198760
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
37198836 |
caaaatgtcgaaattgttaggccagatggcatgatcggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
37198760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 216 - 288
Target Start/End: Original strand, 38140715 - 38140787
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgag |
288 |
Q |
| |
|
|||||| ||||||||||| || ||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
38140715 |
aaaatgccgaaattgttaagccggatgtcatgatcggggttcgaaccccggtacctccatttgtgtgtgtgag |
38140787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 44948042 - 44948118
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| |||||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
44948042 |
caaaatgtcgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttgtatgtgtgagttt |
44948118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 287
Target Start/End: Complemental strand, 7975122 - 7975047
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7975122 |
tggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
7975047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 11543903 - 11543828
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
11543903 |
aaaatgccgaaattgttaggtcggatgccatgatcggggtttgaaccccggtacctccacttgtgtgtgtgagttt |
11543828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 287
Target Start/End: Original strand, 12236145 - 12236216
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12236145 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
12236216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 33898255 - 33898329
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
33898255 |
aaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatccc-gtacctccacttgtgtgtgtgagttt |
33898329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 287
Target Start/End: Original strand, 38463159 - 38463234
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| ||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
38463159 |
tggcaaaatgccgaaattgttaggtcggatgttatgatcggggttcgaaccccgatacctccacttgtgtgtgtga |
38463234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 42414529 - 42414604
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| |||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
42414529 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacatccacttgtgtgtgtgagttt |
42414604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 216 - 281
Target Start/End: Complemental strand, 42007319 - 42007254
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgt |
281 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
42007319 |
aaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgt |
42007254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 8532137 - 8532205
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||| |||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8532137 |
cgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
8532205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 12541433 - 12541365
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
12541433 |
cgaaattgttaggtcggatgtcatgatcggggttcgaacctcggtaccttcacttgtgtgtgtgagttt |
12541365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 40812040 - 40812116
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| |||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
40812040 |
caaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
40812116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 11061407 - 11061481
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| ||||||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
11061407 |
aaaatgtcgaaattgttaggccggatg-catgaccggggttcgaaccccggcacctttactagtgtgtgtgagttt |
11061481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 15488773 - 15488848
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| ||| |||||||||| |||||| | |||||||||||||||||| |
|
|
| T |
15488773 |
aaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccctggtacccccacttgtgtgtgtgagttt |
15488848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 16368796 - 16368717
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||| |||| |||||||||| |||| ||||| ||||||| |
|
|
| T |
16368796 |
tggcaaaataccgaaattgttaggccggatgtcatgatcggggtttgaactccggtacctccacttatgtgtatgagttt |
16368717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 18055883 - 18055958
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||| ||||| ||||||||||||||||||||||||| || |||||| | |||||||||||||||| |
|
|
| T |
18055883 |
aaaatgtcaaaattgctaggccggatgtcatgatcggggttcgaaccgcgttacctccatttgtgtgtgtgagttt |
18055958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 23458712 - 23458779
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
23458712 |
gaaattgttaggctggataccatgaccggggttcgaaccccggtacctccactcgtgtgtgtgagttt |
23458779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 30854839 - 30854764
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
30854839 |
aaaatgtcgaaattgttaggacgaatgtcatgaccggggctcgaaccccggtaccttcacttgtgtgtgtgagttt |
30854764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 33607063 - 33607142
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| |||| ||||| ||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
33607063 |
tggcaaaatgccgaaattgttaggccagatgccatgactggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
33607142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 35706872 - 35706951
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||| | |||| ||||||| ||||||||||||| |
|
|
| T |
35706872 |
tggcaaaatgtcgaaattgttaggtcggatgtcatgactggggttcgaacctcagtacttctacttatgtgtgtgagttt |
35706951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 36794828 - 36794903
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||| | ||| ||||||||||||||||||| |||| |||| |||||||||||||||||| |
|
|
| T |
36794828 |
aaaatgtcaaaattgttaggccgaatgccatgatcggggttcgaacctcggttcctccacttgtgtgtgtgagttt |
36794903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 217 - 291
Target Start/End: Complemental strand, 21840552 - 21840478
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||||||||||||| |||| |||||| ||||||||| |||||||| |
|
|
| T |
21840552 |
aaatgtcgaaattgttaagttggatatcatgatcggggttcgaatcccgatacctccacttgtgtgggtgagttt |
21840478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 225 - 286
Target Start/End: Complemental strand, 12847050 - 12846989
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
12847050 |
aaattgttaggctggatgtcatgatcagggttcgaaccctggtacctcctcttgtgtgtgtg |
12846989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 211 - 296
Target Start/End: Original strand, 18779930 - 18780015
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| ||||| | || |||||||| ||||||||| |||| |||||||||||||||||| |
|
|
| T |
18779930 |
ttggtaaaatgtcgaaattgttaggtcggatgccatgaccaggcttcgaaccacggtacctccacttatgtgtgtgagttttataa |
18780015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 216 - 265
Target Start/End: Original strand, 44765248 - 44765297
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccg |
265 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44765248 |
aaaatgtcgaaattgttaggttggatgtcatgatcggggttcgaaccccg |
44765297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 433161 - 433237
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||| | |||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
433161 |
caaaatgtcgaaattgttaggctggatgccgtgattgaagttcgaaccccgattcctccacttgtgtgtgtgagttt |
433237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 11816885 - 11816805
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| || || | |||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
11816885 |
ttggtaaaatgtcgaaattgttaggccggatgctattattgaggttcgaaccccggtacctccacttgtgtgtgtaagttt |
11816805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 219 - 291
Target Start/End: Complemental strand, 19954999 - 19954928
Alignment:
| Q |
219 |
atgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
19954999 |
atgtcgaaattgttaagtcggatgtcatgatcggagttcgaaccccgatacctctactt-tgtgtgtgagttt |
19954928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 223 - 287
Target Start/End: Original strand, 35493692 - 35493756
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||||||| ||||||| |||||| ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
35493692 |
cgaaattgttaggccggatgtcgtgatcgaggttcgaactccggtacctccacttgtgtgtgtga |
35493756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 10392669 - 10392744
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||| |||||||||| ||||| ||||| ||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
10392669 |
aaaatgccgacattgttaggccggatgccatgaccggagttcgaaccccggtatctccacttgtgtgtgtgagttt |
10392744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 11012007 - 11012074
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||| |||| || |||||| ||||||||||| |
|
|
| T |
11012007 |
gaaattgttaggctggatgccatgatcggagttcgaaccccagtacttccacttgtatgtgtgagttt |
11012074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 18999349 - 18999428
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||| || || |||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
18999349 |
tggcaaaatgccgaaattgttaggtcggatgccattattggagttcgaaccccggttcctccacttgtgtgtgtgagttt |
18999428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 40592333 - 40592412
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| ||||||||||| ||||||| ||| ||||||| |||||||||| |
|
|
| T |
40592333 |
tggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaatcccggtatctccacttgtgcgtgtgagttt |
40592412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 234 - 291
Target Start/End: Original strand, 44276305 - 44276362
Alignment:
| Q |
234 |
ggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
44276305 |
ggctggatgtcatgattggggttcgaaccccggtttctccacttgtgtgtgtgagttt |
44276362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 10202193 - 10202269
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| | ||||||| |||| | ||||||||||| |
|
|
| T |
10202193 |
caaaatgtcgaaattgttaggccggatgctatgatcggggttcgaacttcagtacctccacttatatgtgtgagttt |
10202269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 32120630 - 32120706
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| |||| |||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
32120630 |
tggcaaaatg-cgaaattgttaggccggataccatgatcggggttcgaaccc--ttacctctacttgtgtgtgagagttt |
32120706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 42133550 - 42133466
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| ||||||||| |||| |||||| |||||||| |||||||||||||| |
|
|
| T |
42133550 |
tggcaaaatgccgaaattgttaggtcggatgccatgactagggttcgaatcccgatacctccacttgtgtttgtgagttttataa |
42133466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 6590915 - 6590982
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| |||||| |||| |||||||| || ||||||||||| |||| ||||||||||||| |
|
|
| T |
6590915 |
gaaattgttaggccggatgttatgaccggggttcaaatcccggtacctccacttatgtgtgtgagttt |
6590982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 29741062 - 29740987
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||| || |||||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
29741062 |
aaaatgtcgaaattattaggttggatatcataattggggttcgaatcccggtaccttcacttatgtgtgtgagttt |
29740987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 31054068 - 31054147
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| || || ||||||||||| || |||| ||| ||||||||||||||||| |
|
|
| T |
31054068 |
tggcaaaatgtcgatattgttaggccggatgccaagaccggggttcgaatccaggtatctccgcttgtgtgtgtgagttt |
31054147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 244 - 291
Target Start/End: Original strand, 36755000 - 36755047
Alignment:
| Q |
244 |
catgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36755000 |
catgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36755047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 41196983 - 41197062
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||| || ||||| ||||| |||||||||||||||| ||| || | || ||||||||||||| |
|
|
| T |
41196983 |
tggcaaaatgccgaaattgttaagccggatgccatgaccggggttcgaaccccgatacttccatttatgtgtgtgagttt |
41197062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 216 - 282
Target Start/End: Original strand, 6598424 - 6598490
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtg |
282 |
Q |
| |
|
||||| ||||||||||||||| |||| |||||||||| ||||||||||| ||||||| |||| |||| |
|
|
| T |
6598424 |
aaaatatcgaaattgttaggccggatatcatgatcggcgttcgaaccccagtacctccacttatgtg |
6598490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 216 - 277
Target Start/End: Original strand, 9993194 - 9993255
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
|||||||||||||||||| || ||| ||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
9993194 |
aaaatgtcgaaattgttaagccggacgtcataatcggggttcgaaccccagtacctcaactt |
9993255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 11091692 - 11091615
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||| |||||| || | ||| ||||||||| ||||||||||| |
|
|
| T |
11091692 |
gcaaaatgccgaaattgttaggtcagatgtcatgatcgggattcgaatcctgatacatctacttgtatgtgtgagttt |
11091615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 250 - 291
Target Start/End: Complemental strand, 36216823 - 36216782
Alignment:
| Q |
250 |
cggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36216823 |
cggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36216782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 212 - 264
Target Start/End: Complemental strand, 4695100 - 4695048
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaacccc |
264 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||| ||||||||||||| |
|
|
| T |
4695100 |
tggcaaaatgtcgaaattgttcggtcggatgtcatgatcagggttcgaacccc |
4695048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 7315866 - 7315790
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||| | |||| |||||| ||||||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
7315866 |
caaaatgctgaaattgttagaccggataccatgattggggttcgaactccggtacctccacttatgtgtgtgagttt |
7315790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 284
Target Start/End: Original strand, 18251398 - 18251466
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| | |||||||||| | | ||| |||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
18251398 |
aaaatgccaaaattgttagaccgaatgccatgatcggggttcgaaccctggtacctccacttgtgtgtg |
18251466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 284
Target Start/End: Complemental strand, 19134620 - 19134552
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||||||||||| |||| | ||| ||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
19134620 |
aaaatgtcgaaattgttaggccagatgccgtgaccggagttcgaaccccgatacctccacttgtgtgtg |
19134552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 43841816 - 43841741
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||| |||| | || |||||||||| |||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
43841816 |
aaaatgttgaaattggtaggtcgaatatcatgatcggagttcgaactccgatacctccacttgtgtgtgtgagttt |
43841741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 212 - 282
Target Start/End: Original strand, 4772323 - 4772393
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtg |
282 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| ||||||||||| ||||||||| ||||||||| |
|
|
| T |
4772323 |
tggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaatttcggtacctccacttgtgtg |
4772393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 291
Target Start/End: Original strand, 17882747 - 17882813
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
17882747 |
aaattgttaggctggatgccatgactagggttcgaaccccggtgtctccacttttgtgtgtgagttt |
17882813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 291
Target Start/End: Original strand, 12448908 - 12448985
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| |||| |||||||||| ||||||| | ||||||| ||||||| |||||||||| |
|
|
| T |
12448908 |
gcaaaatatcgaaattgttaggtcggatatcatgatcggcgttcgaattctagtacctcaacttgtgagtgtgagttt |
12448985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 223 - 284
Target Start/End: Original strand, 13774495 - 13774556
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||||||||||| ||||||| | ||||||| ||| ||||| ||||||||||| |
|
|
| T |
13774495 |
cgaaattgttaggctggatgttatgatcgagattcgaactccgataccttcacttgtgtgtg |
13774556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 269
Target Start/End: Complemental strand, 35687890 - 35687837
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtac |
269 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||||||||| ||||||| ||||||| |
|
|
| T |
35687890 |
aaaatgccgaaattgttaggccggatgccatgatcgggattcgaactccggtac |
35687837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 291
Target Start/End: Original strand, 5887603 - 5887667
Alignment:
| Q |
227 |
attgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||| | |||||||||| | |||||||| |||| | ||||||||||| |
|
|
| T |
5887603 |
attgttaggccggatgtcatgaccagggttcgaactctggtacctccacttatatgtgtgagttt |
5887667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 284
Target Start/End: Complemental strand, 12221240 - 12221180
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||| ||| | ||||| | ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
12221240 |
gaaattgttaggccggacgccatgaccagggttcgaaccccagtacctccacttgtgtgtg |
12221180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 22999099 - 22999175
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| | |||||||||| | ||| ||||||| |||||||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
22999099 |
aaaatgccaaaattgttagtccggacgtcatgaccggggttcgaaccccgacacctccactttgtgtgtgtgagttt |
22999175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 31525057 - 31524981
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||| || | | ||||| ||| |||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
31525057 |
caaaatgccgaaattgttatgccgaaaaccatgaccggagttcgaaccccgttacctccacttgtgtgtgtgagttt |
31524981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 292
Target Start/End: Original strand, 42211302 - 42211378
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtttt |
292 |
Q |
| |
|
||||||||||||||||||||| | ||| |||| |||| ||||||||||| |||||| | || ||| |||||||||| |
|
|
| T |
42211302 |
aaaatgtcgaaattgttaggccgcatgctatgaccgggattcgaaccccgatacctccatttatgtatgtgagtttt |
42211378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 7907038 - 7906959
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| || ||||||||||| ||| ||| ||| |||| ||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
7907038 |
tggcaaaatttcaaaattgttaggtcggacgtcgtgactggggatcgaaccccagcacctccacttgtgtgtgtgagttt |
7906959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 287
Target Start/End: Complemental strand, 28855522 - 28855447
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||| | ||||||||||| ||||| ||||| |||||||||| |||||| ||| |||||||||||||| |
|
|
| T |
28855522 |
tggcaaaatgccaaaattgttagggcggatgccatgactggggttcgaatcccggttccttcacttgtgtgtgtga |
28855447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 31516309 - 31516234
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||| ||||||| ||||||||||| |||||| || |||| |||||||| |||| |
|
|
| T |
31516309 |
aaaatgccgaaattgttaggccggaaaccatgatcagggttcgaacctcggtacatccacttttgtgtgtgtgttt |
31516234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 41520530 - 41520597
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||| |||| |||||| | |||||||| ||||||| |
|
|
| T |
41520530 |
gaaattgttaggtcagatgtcatgatcggggtttgaatcccgatacctccatttgtgtgtatgagttt |
41520597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 283
Target Start/End: Original strand, 42030267 - 42030334
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | | ||||||| ||| | |||| |||||||||| |
|
|
| T |
42030267 |
aaaatgtcgaaattgttaggtcggatgtcatgattgagattcgaactccgtttcctccacttgtgtgt |
42030334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 43696434 - 43696507
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgat---cggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||| ||||||| |||||| |||||| || || ||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
43696434 |
aaaatgccgaaattattaggccggatgtaattatgaccggggttcgaaccccggtacctccacttatgtgtgtg |
43696507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 287
Target Start/End: Complemental strand, 8293649 - 8293588
Alignment:
| Q |
226 |
aattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||||| |||| |||||| |||| ||||||||| |
|
|
| T |
8293649 |
aattgttaggccggatgctatgatcgaggttcgaatcccgatacctccacttatgtgtgtga |
8293588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 13491057 - 13491126
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| || ||| ||||||| ||||||||||||| | |||||| || |||||||||||||||| |
|
|
| T |
13491057 |
cgaaattgttatgccggacgtcatgaccggggttcgaacctcaatacctccactttgtgtgtgtgagttt |
13491126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 265
Target Start/End: Complemental strand, 18469540 - 18469487
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccg |
265 |
Q |
| |
|
|||| |||||||||||||||||||| | | ||| ||||||||||| |||||||| |
|
|
| T |
18469540 |
tggctaaatgtcgaaattgttaggccgaacgtcttgatcggggtttgaaccccg |
18469487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 291
Target Start/End: Original strand, 23840879 - 23840916
Alignment:
| Q |
254 |
gttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
23840879 |
gttcgaaccctggtacctccacttgtgtgtgtgagttt |
23840916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 277
Target Start/End: Complemental strand, 25219740 - 25219680
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| |||| ||||||| | |||||||| |||| |
|
|
| T |
25219740 |
aaaatgtcgaaattgttaggccggacgtcatga-cgggattcgaactcaggtacctccactt |
25219680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 39417474 - 39417542
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| ||| || ||| || || ||||||||||||| |
|
|
| T |
39417474 |
cgaaattgttaggccggatgtcatga-cggggttcgaactccgatatctccactttatgtgtgtgagttt |
39417542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 284
Target Start/End: Complemental strand, 7958092 - 7958020
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||| |||||||||| ||| ||||| ||||| |||||||| || ||| ||| ||| ||||||||||| |
|
|
| T |
7958092 |
tggcaaaataccgaaattgttgggccggatgccatgaccggggttcaaaacccagtatctccacttgtgtgtg |
7958020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 264
Target Start/End: Original strand, 16178283 - 16178331
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaacccc |
264 |
Q |
| |
|
|||||| ||||||||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
16178283 |
aaaatgccgaaattgttaggtaggacgccatgatcggggttcgaacccc |
16178331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 18741502 - 18741426
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt-gtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| | | ||||||||| ||||| ||| |||||||||| |||| |||||||||||||| |
|
|
| T |
18741502 |
aaaatgccgaaattgttaggtcgaacatcatgatcgaggttcaaactccggtacctccactttgtgtgtgtgagttt |
18741426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 227 - 283
Target Start/End: Original strand, 30413212 - 30413268
Alignment:
| Q |
227 |
attgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| ||||||||| |||| ||||| |
|
|
| T |
30413212 |
attgttaggtcggatgtcatgatcgaggttcgaacttcggtacctccacttatgtgt |
30413268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 272
Target Start/End: Original strand, 37103346 - 37103402
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctc |
272 |
Q |
| |
|
||||||||||||||||||| | ||| |||||| ||||||| |||||||| |||||| |
|
|
| T |
37103346 |
aaaatgtcgaaattgttagaccggacatcatgaccggggtttgaaccccgatacctc |
37103402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 277
Target Start/End: Complemental strand, 40710918 - 40710878
Alignment:
| Q |
237 |
tggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
40710918 |
tggacgtcatgaccggggttcgaaccccggtacctccactt |
40710878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 79)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 32107943 - 32107864
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
32107943 |
tggcaaaatgccgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacttccacttgtgtgtgtgagttt |
32107864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 216 - 296
Target Start/End: Complemental strand, 1686338 - 1686258
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1686338 |
aaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa |
1686258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 17534631 - 17534547
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
17534631 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttttataa |
17534547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 211 - 296
Target Start/End: Original strand, 27866607 - 27866692
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
||||||||||| | |||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27866607 |
ttggcaaaatgccaaaattgttaggccggatgccatgatcggggttcgaaccccaatacctctacttgtgtgtgtgagttttataa |
27866692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 29479449 - 29479533
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||| ||||||||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
29479449 |
tggcaaaatgtcgaaattgttaggctggatgtcataaccgggattcgaaccccgatacctccagttgtgtgtgtgagttttataa |
29479533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 1241615 - 1241694
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
1241615 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccgctacctccacttgtgtgtgtgagttt |
1241694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 1855030 - 1855105
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1855030 |
aaaatgtcgatattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
1855105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 2959017 - 2959092
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2959017 |
aaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
2959092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 6266652 - 6266731
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||| ||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6266652 |
tggcaaaatgtcgaaattgttagaccggatgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtgagttt |
6266731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 8448250 - 8448171
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8448250 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
8448171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 8457054 - 8456975
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8457054 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
8456975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 8939646 - 8939725
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8939646 |
tggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
8939725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 31205291 - 31205212
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
31205291 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccagtacctccacttgtgtgtgtgagttt |
31205212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 212 - 286
Target Start/End: Complemental strand, 2314707 - 2314633
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2314707 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
2314633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 212 - 286
Target Start/End: Original strand, 21513092 - 21513166
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
21513092 |
tggcaaaatgtcgaaattgttaggccggatgtcatgattggggttcgaaccccagtacctccacttgtgtgtgtg |
21513166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 212 - 290
Target Start/End: Complemental strand, 28594179 - 28594101
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtt |
290 |
Q |
| |
|
|||||||| |||||||||||||||| ||||| ||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
28594179 |
tggcaaaaggtcgaaattgttaggccggatgccatgatcggggttcgaacctcggtacctccacttgtgtgtgtgagtt |
28594101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 212 - 284
Target Start/End: Original strand, 735465 - 735537
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
735465 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtg |
735537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 2301487 - 2301403
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| | ||||||||||| ||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2301487 |
tggcaaaatgccaaaattgttaggtcggatgtcataaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa |
2301403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 5660430 - 5660498
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5660430 |
cgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
5660498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 4480494 - 4480573
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||| ||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
4480494 |
tggcaaaatgccgaaattgttaggccggatgccatgattggggttcgaaccccgttacctccacttgtgtgtgtgagttt |
4480573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 8329666 - 8329587
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8329666 |
tggcaatatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
8329587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 8977179 - 8977254
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| | |||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
8977179 |
aaaatgcccaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccatttgtgtgtgtgagttt |
8977254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 9727519 - 9727594
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
9727519 |
aaaatgtcgaaattgttaggccggataccatgatcggggttcgaacccctgtacctccacttgtgtgtgtgagttt |
9727594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 287
Target Start/End: Complemental strand, 9949255 - 9949184
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9949255 |
aaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
9949184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 10181065 - 10181144
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| |||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
10181065 |
tggcaaaatgccgaaattgttaggtcggatgtcgtgatcggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
10181144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 18861875 - 18861796
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
18861875 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
18861796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 216 - 296
Target Start/End: Complemental strand, 16496756 - 16496676
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| |||||||||||||||||| |||| |||| |||||||||||||||||| |
|
|
| T |
16496756 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttatgtgtgtgagttttataa |
16496676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 216 - 296
Target Start/End: Complemental strand, 31747090 - 31747010
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||||||||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
31747090 |
aaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtaccttcacttatgtgtgtgaggtttataa |
31747010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 8116854 - 8116775
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| ||||||||||||||| ||||| | ||||||| |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
8116854 |
tggcaaaatatcgaaattgttaggccggatgccgtgatcggagttcgaaccccgatacttctacttgtgtgtgtgagttt |
8116775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 12795123 - 12795048
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| ||||||||||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
12795123 |
aaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccgcggtacctccacttatgtgtgtgagttt |
12795048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 13507414 - 13507339
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||| ||| |||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
13507414 |
aaaatgccgaaattgttaggctggatgccatgaccggtgttcgaaccccgatacctccacttgtgtgtgtgagttt |
13507339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 4996895 - 4996971
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
4996895 |
caaaatgctgaaattgttaggccggatgccatgatcggggttcgaatcccagtacctccacttgtgtgtgtgagttt |
4996971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 6556592 - 6556512
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| |||||| |||||||||||||| |||| |||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
6556592 |
ttggtaaaatgccgaaattgttaggccggattctatgatcggggttcgaaccccggtacctccaattgtgtgtgtgagttt |
6556512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 10531409 - 10531485
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||| |||| | ||||||||||| |
|
|
| T |
10531409 |
caaaatatcgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttttatgtgtgagttt |
10531485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 227 - 291
Target Start/End: Original strand, 31057867 - 31057931
Alignment:
| Q |
227 |
attgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31057867 |
attgttaagccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
31057931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 4083607 - 4083686
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| |||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
4083607 |
tggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaacaccggtacctccacttgtgtgcgtgagttt |
4083686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 5626164 - 5626089
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| | ||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5626164 |
aaaatgccgaaattgttaggtagtatgtcatgactggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
5626089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 10263179 - 10263100
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| || |||||||||||||| ||||| ||||| |||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
10263179 |
tggcaaagtgccgaaattgttaggccggatgccatgaccggggttcgaaccctagtacctccacttgtgtgtgtgagttt |
10263100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 216 - 286
Target Start/End: Complemental strand, 32643832 - 32643762
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
32643832 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtgtg |
32643762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 215 - 284
Target Start/End: Original strand, 2746472 - 2746541
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||| || | ||||||||| |
|
|
| T |
2746472 |
caaaatgtcgaaattgttaggccggatgtcatgacaggggttcgaaccccggtacatccatttgtgtgtg |
2746541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 211 - 284
Target Start/End: Complemental strand, 30615021 - 30614948
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||||| ||| |||||| ||||||||||| |
|
|
| T |
30615021 |
ttggcaaaatgtcgaaattgttaggctggatgccatgactggggttcgaattccgatacctccacttgtgtgtg |
30614948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 5603551 - 5603476
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||| |||||| ||||| ||||| |||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
5603551 |
aaaatgccgaaattattaggccggatgccatgaccggggttcgaaccctgatacctccacttgtgtgtgtgagttt |
5603476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 7098830 - 7098905
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| ||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
7098830 |
aaaatgtcgaaattgttaggccggatgccatgactagggttcgaaccttggtacctccacttgtgtgtgtgagttt |
7098905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 8374166 - 8374241
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||||||||||||||||||| | |||||| |||| | ||||||||||| |
|
|
| T |
8374166 |
aaaatgccgaaattgttaggcgggatgccatgatcggggttcgaaccctgatacctccacttatatgtgtgagttt |
8374241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 10330829 - 10330904
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| | |||||||||||| |||| ||||| ||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10330829 |
aaaatgccaaaattgttaggccagatgccatgaccggggatcgaaccccggtacctccacttgtgtgtgtgagttt |
10330904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 15953258 - 15953333
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||| | | |||| |||| ||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
15953258 |
aaaatgccgaaattgttagaccgaatgtaatgaccggggttcgaaccccggtacctccacttgtatgtgtgagttt |
15953333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 271
Target Start/End: Original strand, 16244431 - 16244490
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacct |
271 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| ||||||||||||||| |||||| |
|
|
| T |
16244431 |
tggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccagtacct |
16244490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 24571721 - 24571646
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | |||||||||||||| | |||| |||||||||||| ||||| |
|
|
| T |
24571721 |
aaaatgtcgaaattgttaggccagatgtcatgaccagggttcgaaccccgttccctccacttgtgtgtgtaagttt |
24571646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 34287279 - 34287200
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||| |||||||||| ||||| ||||| |||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
34287279 |
tggcaaaatgccgacattgttaggccggatgccatgaccggggttcgaaccccggtactttcacttgtgtgtatgagttt |
34287200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 34830802 - 34830877
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||| ||| ||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
34830802 |
aaaatgccgaaattgttaggtcggatgccatgaccggagttcgaagcccggtacctctacttgtgtgtatgagttt |
34830877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 216 - 286
Target Start/End: Complemental strand, 35164711 - 35164641
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||| |||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
35164711 |
aaaatgttgaaattgttaggccggatgccatgaccggggttcgaacaccggttcctccacttgtgtgtgtg |
35164641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 287
Target Start/End: Original strand, 659200 - 659249
Alignment:
| Q |
238 |
ggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
659200 |
ggatgtcatgaccggggttcaaaccccggtacctctacttgtgtgtgtga |
659249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 215 - 288
Target Start/End: Complemental strand, 10318992 - 10318919
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgag |
288 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||| ||| ||| |||||||||||||| |||| |||||||||| |
|
|
| T |
10318992 |
caaaatgtcgaaattgttaggttggatgccatgaccggagtttaaaccccggtacctccacttatgtgtgtgag |
10318919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 2236257 - 2236333
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||| |||||| ||||||||| | ||||||||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
2236257 |
caaaatgccgaaattattaggccggatgtcataactggggttcgaactccggttcctccacttgtgtgtgtgagttt |
2236333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 211 - 263
Target Start/End: Complemental strand, 14465931 - 14465879
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccc |
263 |
Q |
| |
|
|||| |||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14465931 |
ttggtaaaatgccaaaattgttaggctggatgtcatgatcggggttcgaaccc |
14465879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 14982751 - 14982683
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||| ||| | || ||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
14982751 |
cgaaattgttaggccggatgccataaccgaggttcgaaccctggtacctccacttgtgtgtgtgagttt |
14982683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 17546059 - 17546135
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||||||| || |||||||| | |||||||||| |
|
|
| T |
17546059 |
caaaatgtcgaaattgttaggtcggatgtcatgatcggagtttgaaccccgatatctctacttatacgtgtgagttt |
17546135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 227 - 291
Target Start/End: Original strand, 29183693 - 29183757
Alignment:
| Q |
227 |
attgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||||||| || ||| |||||||||||||||||| |
|
|
| T |
29183693 |
attgttaggccggatgccatgaccggggttcgaaccccgatatctccacttgtgtgtgtgagttt |
29183757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 13540269 - 13540190
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||| |||| || ||| |||||||| || |||||||||||||||||| |
|
|
| T |
13540269 |
tggcaaaatgccgaaattgttaggccggatgcaatgaccgggatttgaatcccggtacgtccacttgtgtgtgtgagttt |
13540190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 225 - 291
Target Start/End: Original strand, 11152550 - 11152616
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| || ||||| ||||| ||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
11152550 |
aaattgttaagccggatgccatgaccggggttcgaatcccggtacatccacttgtgtgtgtgagttt |
11152616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 217 - 291
Target Start/End: Complemental strand, 31242093 - 31242020
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||||| |||| ||||| || ||||||||||||||| |
|
|
| T |
31242093 |
aaatgtcgaaattgttaggccggacgtcatgaccggggttcgaatcccgacacctccac-tgtgtgtgtgagttt |
31242020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 214 - 279
Target Start/End: Complemental strand, 23383162 - 23383097
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgt |
279 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
23383162 |
gcaaaatgctgaaattgttaggtcagatgtcataatcggggttcgaaccccggtacctccacttgt |
23383097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 292
Target Start/End: Original strand, 34762699 - 34762768
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtttt |
292 |
Q |
| |
|
||||||| |||||| ||| | |||||||||||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
34762699 |
cgaaattattaggccggacgccatgatcggggttcgaaccccggtgccttcacttgcgtgtgtgagtttt |
34762768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 1266846 - 1266770
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctcta-cttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||| ||||||||||||||||| ||| | ||||||| | |||||||||||||||| |
|
|
| T |
1266846 |
aaaatgccgaaattgttaggccggacgtcatgatcggggttcggacctcagtacctccattttgtgtgtgtgagttt |
1266770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 284
Target Start/End: Complemental strand, 31444394 - 31444326
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| |||||||||||||| || || ||||| |||||||||||||||||||||| |||| |||||| |
|
|
| T |
31444394 |
aaaatgccgaaattgttaggccgggtgccatgactggggttcgaaccccggtacctccacttatgtgtg |
31444326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 4891032 - 4891107
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| |||||||||| ||||||| ||| | || |||||| |||| ||||||||||||| |
|
|
| T |
4891032 |
aaaatgccgaaattgttaggccagatgtcatgaccggggtttgaatctcgatacctccacttatgtgtgtgagttt |
4891107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 8487657 - 8487582
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| | ||| || |||| | |||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
8487657 |
aaaatgccgaaattgttaggccgaatgctattatcgagattcgaaccccggtacctccacttatgtgtgtgagttt |
8487582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 232 - 291
Target Start/End: Original strand, 34539332 - 34539391
Alignment:
| Q |
232 |
taggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| ||||| ||||| ||||||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
34539332 |
taggccggatgccatgaccggggttcgaaacccggtacctccacttatgtgtgtgagttt |
34539391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 9297781 - 9297857
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcgggg-ttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| || |||||||| |||| |||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
9297781 |
aaaatgtcgaaattgttaggccagacgtcatgattggggtttcgaa-cccggtacctccactttgtgtgtgtgagttt |
9297857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 211 - 296
Target Start/End: Complemental strand, 31222742 - 31222658
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||||| | | ||||||||||||||||||| |||| |||||||| |||||||| |
|
|
| T |
31222742 |
ttggcaaaatgctgaaattgttaagtcggatgtcatgaccagagttcgaaccccggtacctccacttacgtgtgtga-ttttataa |
31222658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 3456500 - 3456576
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| |||||||||||| | ||| | ||||| | ||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
3456500 |
caaaatgtcaaaattgttaggccgtatgccttgatcagaattcgaactccggtaccttcacttgtgtgtgtgagttt |
3456576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 5015877 - 5015801
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||| |||||| ||| |||||||||||||||| ||| ||| ||||| || |||||||||| ||||| |
|
|
| T |
5015877 |
caaaatgctgaaattattaggccggacgtcatgatcggggttccaactccgatacctttaattgtgtgtgttagttt |
5015801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 284
Target Start/End: Complemental strand, 11242701 - 11242633
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||| |||||||||||||| || |||| ||||||||||| |
|
|
| T |
11242701 |
aaaatgccgaaattgttaggacggatgccatgactggggttcgaacccctgttcctccacttgtgtgtg |
11242633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 2018866 - 2018791
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| ||||||||| || ||||||||| | | |||||| |||||||||||| ||||| |
|
|
| T |
2018866 |
aaaatgtcgaaattgttaggtcaaatgtcatgaccgtggttcgaactctgctacctccacttgtgtgtgtaagttt |
2018791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 283
Target Start/End: Original strand, 9329009 - 9329076
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
|||||||||||||||||| || ||| || ||||||||| ||||||| |||| ||||| |||| ||||| |
|
|
| T |
9329009 |
aaaatgtcgaaattgttatgccggacgttatgatcgggattcgaactccggcacctccacttatgtgt |
9329076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 22721275 - 22721345
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
22721275 |
aaaatgttgaaattgttaggccggatactatgatcggggttttaaccccgacacctccacttgtgtgtgtg |
22721345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 7974813 - 7974736
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcgggg-ttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| ||| |||||||||||| || |||||||| ||||| | |||||||||||||||| |
|
|
| T |
7974813 |
caaaatgccgaaattgttaggtcggacatcatgatcgggggtttgaaccccgataccttcagttgtgtgtgtgagttt |
7974736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 291
Target Start/End: Complemental strand, 9063074 - 9063005
Alignment:
| Q |
222 |
tcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||||||||||| | |||| |||||||||| ||||||| |
|
|
| T |
9063074 |
tcgaaattgttaagctggacgtcttgacgggggttcgaacccccgcccctccacttgtgtgtatgagttt |
9063005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 252 - 284
Target Start/End: Original strand, 25121888 - 25121920
Alignment:
| Q |
252 |
gggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
25121888 |
gggttcgaaccccggtacctccacttgtgtgtg |
25121920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 146)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 16371580 - 16371501
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16371580 |
tggcaaaatgccaaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
16371501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 9902609 - 9902525
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9902609 |
tggcaaaatgccgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa |
9902525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 4164979 - 4165058
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4164979 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
4165058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 16496620 - 16496699
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16496620 |
tggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
16496699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 37940938 - 37941017
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
37940938 |
tggcaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
37941017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 42068561 - 42068640
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42068561 |
tggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
42068640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 42448231 - 42448310
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42448231 |
tggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
42448310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 10165551 - 10165631
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| |||||||||||| | ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10165551 |
ttggcaaaatgccgaaattgttagaccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
10165631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 4617870 - 4617795
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4617870 |
aaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
4617795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 6672261 - 6672340
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6672261 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
6672340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 34930245 - 34930324
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34930245 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
34930324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 36569299 - 36569378
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36569299 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36569378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 36854266 - 36854187
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36854266 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36854187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 39151030 - 39150955
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39151030 |
aaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
39150955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 213 - 291
Target Start/End: Original strand, 34675768 - 34675846
Alignment:
| Q |
213 |
ggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34675768 |
ggcaaaatgccgaaattgttaggttggatgccatgatcgggattcgaaccccggtacctccacttgtgtgtgtgagttt |
34675846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 1287334 - 1287414
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1287334 |
ttggtaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
1287414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 212 - 288
Target Start/End: Original strand, 18473934 - 18474010
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgag |
288 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18473934 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
18474010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 671167 - 671088
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||| || ||||||||||||||| |
|
|
| T |
671167 |
tggcaaaatgccgaaattgttaggtcggatgtcatgatcggggttcgaaccccgatacctccacgtgtgtgtgtgagttt |
671088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 2103046 - 2103125
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2103046 |
tggcaaaatgccgaaattgttaggccggatgccatgatcgggattcgaaccccggtacctacacttgtgtgtgtgagttt |
2103125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 6029632 - 6029711
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6029632 |
tggcaaaatgtcaaaattgttaggccggatgtcatgcctggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
6029711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 23074748 - 23074673
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23074748 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
23074673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 23311281 - 23311202
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
23311281 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
23311202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 24652422 - 24652343
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| |||| || ||||||||||||||| |||||||||||||||||| |
|
|
| T |
24652422 |
tggcaaaatgtcgaaattgttaggccggatgccatgaccgggatttgaaccccggtacctccacttgtgtgtgtgagttt |
24652343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 25328412 - 25328333
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| || |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25328412 |
tggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacctccacttgtgtgtgtgagttt |
25328333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 26802354 - 26802433
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26802354 |
tggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
26802433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 26809904 - 26809983
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26809904 |
tggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
26809983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 26824931 - 26825010
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26824931 |
tggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
26825010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 28143340 - 28143261
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28143340 |
tggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
28143261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 29119626 - 29119705
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
29119626 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
29119705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 211 - 290
Target Start/End: Complemental strand, 29293631 - 29293552
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtt |
290 |
Q |
| |
|
|||||||| || |||||||||||||| ||||| ||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
29293631 |
ttggcaaagtgccgaaattgttaggccggatgccatgatcggggttcgaacctcggtacctccacttgtgtgtgtgagtt |
29293552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 36259821 - 36259896
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
36259821 |
aaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggtacctccacttatgtgtgtgagttt |
36259896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 37191264 - 37191343
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||||||||| |||||||||| |||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
37191264 |
tggcaaaatgccaaaattgttaggctggatgccatgatcgggattcgaaccccggtacctccacttatgtgtgtgagttt |
37191343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 43150266 - 43150187
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43150266 |
tggcaaaatggcgaaattgttaggccggatgctatgattggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
43150187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 214 - 291
Target Start/End: Original strand, 1650313 - 1650390
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||| |||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
1650313 |
gcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttgtgtgtgtgagttt |
1650390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 212 - 281
Target Start/End: Original strand, 16906357 - 16906426
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgt |
281 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16906357 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgt |
16906426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 1269624 - 1269548
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||| |||| | ||||||||||| |
|
|
| T |
1269624 |
caaaatgtcgaaattgttaggccggatgccatgattggggttcgaaccccggtacctccacttatttgtgtgagttt |
1269548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 11968799 - 11968875
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| ||||||||||||||| ||||||| |||||||||| ||||||| |
|
|
| T |
11968799 |
caaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccagtacctccacttgtgtgtatgagttt |
11968875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 216 - 296
Target Start/End: Original strand, 21728685 - 21728765
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| |||||||||||||||||| |||| |||| |||||||||||||||||| |
|
|
| T |
21728685 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttatgtgtgtgagttttataa |
21728765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 216 - 284
Target Start/End: Original strand, 39527956 - 39528024
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39527956 |
aaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtg |
39528024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 972698 - 972623
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
972698 |
aaaatgtcgaaattgttaggtcggatgctatgaccagggttcgaaccccggtacctctacttgtgtgtgtgagttt |
972623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 4430045 - 4429970
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| ||||||| |||||| |||| ||||||||||||| |
|
|
| T |
4430045 |
aaaatgtcgaaattgttaggccggatgtcatgaccggggttcaaaccccgatacctccacttatgtgtgtgagttt |
4429970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 9054079 - 9054000
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| |||||||||||||| ||||| ||||| |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
9054079 |
tggcaaaataccgaaattgttaggccggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
9054000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 9068827 - 9068902
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
9068827 |
aaaatgtcgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacctccattagtgtgtgtgagttt |
9068902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 287
Target Start/End: Complemental strand, 17869232 - 17869157
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
17869232 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtga |
17869157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 27390035 - 27389956
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
27390035 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacctcggtacctccacttatgtgtgtgagttt |
27389956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 34856605 - 34856680
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
34856605 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
34856680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 287
Target Start/End: Original strand, 36185157 - 36185232
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
36185157 |
tggcaaaatgtcgaaattgttaggtcagatatcatgatcggggttcgaaccccggtacctccacttgtgtgcgtga |
36185232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 38682948 - 38683027
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38682948 |
tggcaaaatgccaaaattgttaggctggatgccatgaccggggttcgaaccccggtaccctcacttgtgtgtgtgagttt |
38683027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 40199208 - 40199133
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
40199208 |
aaaatgccgaaattgttaggctggatgtcatgatcgaagttcgaaccccggtacctccacttatgtatgtgagttt |
40199133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 41562478 - 41562557
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
41562478 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggagttcgaactccggtacctccacttgtgtgtgtgagttt |
41562557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 5203575 - 5203645
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| |||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
5203575 |
aaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtg |
5203645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 36136968 - 36136891
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||||| | ||| |||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36136968 |
gcaaaatgccgaaattgttaggccgaatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36136891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 212 - 284
Target Start/End: Complemental strand, 12878226 - 12878154
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
12878226 |
tggcaaaatgccgaaattgttaggccggatgtcatgatcgaagttcgaaccccgatacctccacttgtgtgtg |
12878154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 20695588 - 20695512
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| ||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
20695588 |
caaaatgccgaaattgttaggcccgatgtcatgaccggggttcgaacccctatacctccacttgtgtgtgtgagttt |
20695512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 33028253 - 33028329
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||| |||||||||||||||||||| || |||| ||||||||||||| |
|
|
| T |
33028253 |
caaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacttccacttatgtgtgtgagttt |
33028329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 227 - 291
Target Start/End: Complemental strand, 36246087 - 36246023
Alignment:
| Q |
227 |
attgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36246087 |
attgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36246023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 41071081 - 41071161
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| |||||| |||||||||||||| || || ||||||||| |||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
41071081 |
ttggtaaaatgccgaaattgttaggccgggtgccatgatcggagttcgaaccccgatacctccacttgtgtgtgtgagttt |
41071161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 1244289 - 1244210
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||| |||||||| ||||| ||||||| |||| |
|
|
| T |
1244289 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgagtgtgtgggttt |
1244210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 1833423 - 1833348
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||| |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
1833423 |
aaaatgccgaaattgttaggccggataccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
1833348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 291
Target Start/End: Complemental strand, 2025777 - 2025710
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
2025777 |
gaaattgttaggtcggatgtcatgatcggggttcgaactccggtacctccacttatgtgtgtgagttt |
2025710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 8487417 - 8487496
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | ||||||||| |||||||||||||| ||||||| ||| | ||||||||| |||||||||||||||||| |
|
|
| T |
8487417 |
tggcaaaatgccaaaattgttaagctggatgtcatgaccggggtttgaatctcggtacctccacttgtgtgtgtgagttt |
8487496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 10393606 - 10393531
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||| |||||| ||||| | ||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10393606 |
aaaatgccgaaattattaggccggatgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
10393531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 283
Target Start/End: Complemental strand, 15067244 - 15067177
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
15067244 |
aaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggtacatccacttgtgtgt |
15067177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 24443975 - 24443896
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |||| |||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
24443975 |
tggcaaaataccgaaattgttaggtcggatgttatgaccggggttcaaaccccggtacctccacttgtgtgtgtgagttt |
24443896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 24637978 - 24638053
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| ||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
24637978 |
aaaatgttgaaattgttaggccggatgtcatgattggggttcgaaccccggtttcttcacttgtgtgtgtgagttt |
24638053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 36790419 - 36790344
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||| |||||| ||||| |||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36790419 |
aaaatgccgaaattattaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36790344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 40318889 - 40318814
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||| |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
40318889 |
aaaatgccgaaattgttaggccggataccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
40318814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 40595977 - 40596055
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| | ||| ||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40595977 |
tggcaaaatgccgaaattgttaggccg-atgccatgactggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
40596055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 42337951 - 42337872
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| ||||| |||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
42337951 |
tggcaaaatgccgaaattgttaggtcggatgtcataatcggagttcgaactctggtacctccacttgtgtgtgtgagttt |
42337872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 212 - 286
Target Start/End: Complemental strand, 26267109 - 26267035
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||| ||||||||||| || ||||| ||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
26267109 |
tggcaaaatgccgaaattgttaagccggatgccatgatcggatttcgaaccccggtacctccacttgtgtgtgtg |
26267035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 211 - 296
Target Start/End: Original strand, 10458745 - 10458830
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||| |||||| | |||||||||||| ||||| |||||||||||||||||||||||||||| |||||| |||||| |||||||| |
|
|
| T |
10458745 |
ttggtaaaatgccaaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtatgtgtggattttataa |
10458830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 215 - 287
Target Start/End: Original strand, 12665118 - 12665190
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||||| ||||||| |||||| ||||| ||||| |||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
12665118 |
caaaatgccgaaattattaggccggatgccatgaccggggttcgaactccggtacctccacttgtgtgtgtga |
12665190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 35933082 - 35933006
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||| ||||| | |||||||||||||||||||| |||| || |||| ||||||||||||| |
|
|
| T |
35933082 |
caaaatgtagaaattgttaggttggatattatgatcggggttcgaaccccagtacttccacttatgtgtgtgagttt |
35933006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 36727009 - 36727086
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||| ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
36727009 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggt--gaaccccggtacctccacttgtctgtgtgagttt |
36727086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 42559934 - 42559858
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| ||||| || |||||||||| |||| ||||||||||||| |
|
|
| T |
42559934 |
caaaatgtcgaaattgttaggccggatgtaatgatcgaggttcaaattccggtacctccacttatgtgtgtgagttt |
42559858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 1277462 - 1277537
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||| |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
1277462 |
aaaatgccgaaattgttaggccggatgccatgacagggattcgaacctcggtacctccacttgtgtgtgtgagttt |
1277537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 4874349 - 4874274
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||| |||||| | || ||| ||||||||| |
|
|
| T |
4874349 |
aaaatgtcgaaattgttaggacggatgttatgatcggggttcgaaccccgatacctccatttatgtatgtgagttt |
4874274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 6041948 - 6041873
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||| |||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6041948 |
aaaatgtcgaaattattaggccggatgctatgaccgggattcgaaccccggtaccttcacttgtgtgtgtgagttt |
6041873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 14126935 - 14127002
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
14126935 |
gaaattgttaggccggatctcatgaccggggttcgaatcccggtacctccacttgtgtgtgcgagttt |
14127002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 18625723 - 18625644
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||| | |||| ||||||||||||||||||||| ||||||| |||||| ||||||||||| |
|
|
| T |
18625723 |
tggcaaaatgccaaaattgttagtccagatgccatgatcggggttcgaaccccagtacctccacttgtatgtgtgagttt |
18625644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 224 - 291
Target Start/End: Complemental strand, 25567778 - 25567711
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||| ||||| |||||||||||||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
25567778 |
gaaattattaggccggatgccatgatcggggttcgaaccccgttacctccacttctgtgtgtgagttt |
25567711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 29806591 - 29806666
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| | |||||||||||| ||||| ||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29806591 |
aaaatgccaaaattgttaggccggatgccatgactggggttcgaaccccggtaccttcacttgtgtgtgtgagttt |
29806666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 33617120 - 33617195
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||| |||||||||| ||||| ||||| |||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
33617120 |
aaaatgccgacattgttaggccggatgctatgattggggttcgaaccccggtatctccacttgtgtgtgtgagttt |
33617195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 224 - 287
Target Start/End: Complemental strand, 36319598 - 36319535
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36319598 |
gaaattgttaggccggatgccatgacaggggttcgaaccccggtacctccacttgtgtgtgtga |
36319535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 41408651 - 41408726
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| |||| ||| | |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
41408651 |
aaaatgccgaaattgttaggccggataccataaccggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
41408726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 215 - 277
Target Start/End: Complemental strand, 6053156 - 6053094
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
6053156 |
caaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccactt |
6053094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 225 - 291
Target Start/End: Complemental strand, 9722169 - 9722103
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
9722169 |
aaattgttaagttggataccatgatcggggttcgaacaccggtacctctacttgtgtgtgagagttt |
9722103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 216 - 282
Target Start/End: Complemental strand, 10109995 - 10109929
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtg |
282 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| || |||||||||| ||||||||| ||||||||| |
|
|
| T |
10109995 |
aaaatgtcgatattgttaggccggatgtcatgaccgaggttcgaacctcggtacctccacttgtgtg |
10109929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 216 - 286
Target Start/End: Complemental strand, 27004069 - 27003999
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||| |||||||||||| ||||||| ||||||||||||||||| ||||| ||||| |||| |||||||| |
|
|
| T |
27004069 |
aaaatgccgaaattgttagtctggatgccatgatcggggttcgaatcccggcacctccacttatgtgtgtg |
27003999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 212 - 286
Target Start/End: Original strand, 39143461 - 39143534
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||||||||||||||||||||| | ||| ||||| || |||||||| ||||||||||| ||||||||||||| |
|
|
| T |
39143461 |
tggcaaaatgtcgaaattgttaggccgaatgccatgaccgaggttcgaa-cccggtacctccacttgtgtgtgtg |
39143534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 215 - 284
Target Start/End: Complemental strand, 10154267 - 10154198
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||| ||||||||| |||| ||||| ||||| |||||||||||||||||||| || ||||||||||| |
|
|
| T |
10154267 |
caaaatgccgaaattgtcaggccggatgccatgaccggggttcgaaccccggtacttccacttgtgtgtg |
10154198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 211 - 284
Target Start/End: Original strand, 14107271 - 14107344
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||| |||||| ||||| |||||||| ||||| ||||| ||||||||||||||||||||||| |||| |||||| |
|
|
| T |
14107271 |
ttggtaaaatgccgaaactgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtg |
14107344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 287
Target Start/End: Original strand, 17080488 - 17080560
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| |||||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
17080488 |
caaaatgtcgaaattgttaagtcggatgtcatgacgggggttcgaacctcggtacctccacttatgtgtgtga |
17080560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 1612397 - 1612472
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| ||| |||| | || ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
1612397 |
aaaatgttgaaattgttaggccggacatcataaccgcggttcgaaccccgatacctccacttgtgtgtgtgagttt |
1612472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 9640642 - 9640563
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||| |||||||||| | ||| || |||||| |||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
9640642 |
tggcaaaatgccgatattgttaggccgaatgctataatcgggattcgaaccccggtacctccacttatgtgtgtgagttt |
9640563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 287
Target Start/End: Original strand, 12262895 - 12262966
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||| ||||||||||||| |||| | ||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
12262895 |
aaaatgccgaaattgttaggtcggatattatgatcggggttcgaacccaagtacctccacttgtgtgtgtga |
12262966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 19867385 - 19867310
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||||| | ||||||| ||||||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
19867385 |
aaaatgccgaaattgttaggcttcacgtcatgaccggggttcgaaccccagtaccttcacttatgtgtgtgagttt |
19867310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 24051423 - 24051502
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||| |||||| ||||| ||||| |||||||||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
24051423 |
tggcaaaatgctaaaattattaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtatgtgagttt |
24051502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 29622237 - 29622303
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||||||||| ||||||| |||| ||||||||||||| |
|
|
| T |
29622237 |
gaaattgttaggccggatgccatgaccggggttcgaacccc-gtacctccacttatgtgtgtgagttt |
29622303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 40045024 - 40044945
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| | ||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
40045024 |
tggcaaaatgccgaaattgttaggtcggatgccatgaccagggttcgaatcctagtacctccacttgtgtgtgtgagttt |
40044945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 43070792 - 43070713
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| | ||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
43070792 |
tggcaaaatgccgaaattgttaggtcggatgccatgacggaggttcgaaccccggttcctccacttatgtgtgtgagttt |
43070713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 10011494 - 10011564
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||| |||||||| |||||||||| |||| ||| |||| |
|
|
| T |
10011494 |
aaaatgtcgaaattgttaggtcggatgccatgatcggagttcgaactccggtacctccacttatgtatgtg |
10011564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 217 - 283
Target Start/End: Complemental strand, 31895615 - 31895549
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
31895615 |
aaatgccgaaattgttaggcaggatgtcatgactaaggttcgaaccccggtacctccacttgtgtgt |
31895549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 228 - 289
Target Start/End: Complemental strand, 16667123 - 16667062
Alignment:
| Q |
228 |
ttgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagt |
289 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||| |||| |||||| |||| |
|
|
| T |
16667123 |
ttgttaggccagatgccatgatcggggttcgaaccccggtacctccacttctgtgtgagagt |
16667062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 214 - 291
Target Start/End: Original strand, 18115115 - 18115192
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||| |||| | ||| |||| |||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
18115115 |
gcaaaatgtcaaaattgttaggccggataccgtgaccgggattcgaaacccggtacctccacttatgtgtgtgagttt |
18115192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 216 - 289
Target Start/End: Complemental strand, 22511898 - 22511825
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagt |
289 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||| | ||||||| ||||||| ||||||| |
|
|
| T |
22511898 |
aaaatgtcaaaattgttaggctggatgtcatgatcggggtttgaattctggtaccttcgcttgtgtatgtgagt |
22511825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 215 - 284
Target Start/End: Original strand, 37067724 - 37067792
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||| ||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
37067724 |
caaaatgccgaaattgttaggccggatgccatgaccggagttcgaacccc-gtacctccacttgtgtgtg |
37067792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 230 - 291
Target Start/End: Complemental strand, 38975828 - 38975767
Alignment:
| Q |
230 |
gttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||| || || |||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
38975828 |
gttaggccggatgccacgaccggggttcgaactccggtacctccacttgtgtgtgtgagttt |
38975767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 7809607 - 7809674
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||| ||||| ||||||| |||| ||||||||||||| |
|
|
| T |
7809607 |
cgaaattattaggc-ggatgtcatgatcggggttcaaaccctagtacctcaacttatgtgtgtgagttt |
7809674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 239 - 291
Target Start/End: Original strand, 9716334 - 9716386
Alignment:
| Q |
239 |
gatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
9716334 |
gatgccatgaccggggttcgaaccccggtacctctacttgtgtctgtaagttt |
9716386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 30528006 - 30528082
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||| ||||||||| | |||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
30528006 |
aaaatgccgaaattgttaggccggacatcatgatcgagattcgaaccccggcacctccactttgtgtgtgtgagttt |
30528082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 30568346 - 30568422
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||| ||||||||| | |||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
30568346 |
aaaatgccgaaattgttaggccggacatcatgatcgagattcgaaccccggcacctccactttgtgtgtgtgagttt |
30568422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 42653564 - 42653640
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||| |||| || || ||| |||| ||||||||||||| |
|
|
| T |
42653564 |
caaaatgtcgaaattgttagaccggatgtcatgaccggggtttgaacttcgatatctccacttatgtgtgtgagttt |
42653640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 43237833 - 43237908
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||| || |||| |||||||||||||||||| |||| ||||||||||| |
|
|
| T |
43237833 |
aaaatgtcaaaattgttag-ctggacgtcatgaccgaggtttgaaccccggtacctctactttgtatgtgtgagttt |
43237908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 7179409 - 7179330
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||| |||| ||| || || ||||||| |||| ||||||||||||| |
|
|
| T |
7179409 |
tggcaaaatgtcgaaattgttaggccagatgccatgaccgggattcaaatccttgtacctccacttatgtgtgtgagttt |
7179330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 12707984 - 12707905
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||| | | | ||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
12707984 |
tggcaaaatgccgaaattgttaggtcggatgccatcaccagagttcgaaccccaatacctccacttgtgtgtgtgagttt |
12707905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 27389679 - 27389758
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | ||||||||| || | || |||||||||||||| ||||||| |||||| |||| ||||||||||||| |
|
|
| T |
27389679 |
tggcaaaatgccaaaattgttaagccgaatatcatgatcggggtttaaaccccgatacctccacttatgtgtgtgagttt |
27389758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 35232567 - 35232642
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||| | |||||||||| |||||||| |||||| ||||| |||||||||||||||||| |
|
|
| T |
35232567 |
aaaatgacgaaattgttagatcgaatgtcatgattggggttcggaccccgataccttcacttgtgtgtgtgagttt |
35232642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 215 - 285
Target Start/End: Complemental strand, 1931194 - 1931124
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgt |
285 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| |||||||||||| | ||| ||| |||||||||||| |
|
|
| T |
1931194 |
caaaatgtcgaaattgttaggccggatgctatgactggggttcgaacctcagtatctccacttgtgtgtgt |
1931124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 291
Target Start/End: Original strand, 6525870 - 6525939
Alignment:
| Q |
222 |
tcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| ||||||||| || |||||||||||||||||||| |||||| || |||||||||||||||| |
|
|
| T |
6525870 |
tcgaaattgctaggctggacgt-atgatcggggttcgaaccccaatacctccactttgtgtgtgtgagttt |
6525939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 217 - 291
Target Start/End: Original strand, 28869975 - 28870049
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| ||||||||||||||| | ||||||| | | || ||||||||| ||| |||| |||||||||||||||||| |
|
|
| T |
28869975 |
aaatatcgaaattgttaggccgaatgtcataacctggattcgaaccctggtccctccacttgtgtgtgtgagttt |
28870049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 32466593 - 32466663
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||| ||| |||||||||||| |||||| |||| |||||||| |
|
|
| T |
32466593 |
aaaatgtcgaaattattaggccggatgctatgaccggagttcgaaccccgatacctccacttatgtgtgtg |
32466663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 268
Target Start/End: Original strand, 4228877 - 4228933
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggta |
268 |
Q |
| |
|
||||||||||||||||||||||| | | || |||||||||||||| |||||||||| |
|
|
| T |
4228877 |
tggcaaaatgtcgaaattgttagaccgaataccatgatcggggttccaaccccggta |
4228933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 6219287 - 6219220
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||||||||| ||| |||||||||| |||| ||| | |||||||||||||||| |
|
|
| T |
6219287 |
cgaaattgttaggtcggatgtcatgaccggtgttcgaaccctggta-ctccatttgtgtgtgtgagttt |
6219220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 18990631 - 18990563
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| |||| ||||||||| |||||||||||||||| || || | ||||| |||||||||| |
|
|
| T |
18990631 |
cgaaattgttaagctgaatgtcatgaccggggttcgaaccccgatatctacatttgtgcgtgtgagttt |
18990563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 284
Target Start/End: Original strand, 23310420 - 23310492
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||| | |||||||||||| ||||| ||||| | | |||| |||||||||||||| ||||||||||| |
|
|
| T |
23310420 |
tggcaaaataccaaaattgttaggccggatgccatgaccagagttcaaaccccggtacctccacttgtgtgtg |
23310492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 284
Target Start/End: Complemental strand, 32274084 - 32274012
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||| |||||||||||| |||| ||||| ||||||||||||||||||| ||| |||||||||| |
|
|
| T |
32274084 |
tggcaaaatgctgaaattgttagggcggataccatgaccggggttcgaaccccggtaactccgcttgtgtgtg |
32274012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 238 - 286
Target Start/End: Complemental strand, 42645547 - 42645499
Alignment:
| Q |
238 |
ggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||| ||| |||| |
|
|
| T |
42645547 |
ggatgtcatgatcggggttcgaacctcggtacctccacttatgtatgtg |
42645499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 7153287 - 7153236
Alignment:
| Q |
221 |
gtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctc |
272 |
Q |
| |
|
|||||||||||||||| |||||| ||||| |||||| |||||||| |||||| |
|
|
| T |
7153287 |
gtcgaaattgttaggccggatgttatgattggggtttgaaccccgatacctc |
7153236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 12638572 - 12638498
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| ||||||||||||||| ||| | | ||| |||||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
12638572 |
aaaatatcgaaattgttaggccggacgccttgacgggggttcgaacccc-gtccctccacttgtgtgtgtgagttt |
12638498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 12769229 - 12769154
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||| | | | ||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
12769229 |
aaaatgccgaaattgttaggtcggatgccatcaccagagttcgaaccccaatacctccacttgtgtgtgtgagttt |
12769154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 19836195 - 19836116
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||| |||| || | | ||||||||||| ||||||| |||||||||| |
|
|
| T |
19836195 |
tggcaaaatgtcgaaattgttaggtcggatgctgtgaccgggatttgtatcccggtacctccacttgtgcgtgtgagttt |
19836116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 271
Target Start/End: Complemental strand, 23219224 - 23219169
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacct |
271 |
Q |
| |
|
|||||| | |||||||||||| | ||| ||||||||||||||||||| |||||||| |
|
|
| T |
23219224 |
aaaatgccaaaattgttaggccgtatgccatgatcggggttcgaacctcggtacct |
23219169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 252 - 291
Target Start/End: Complemental strand, 41958097 - 41958058
Alignment:
| Q |
252 |
gggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
41958097 |
gggttcgaacctcggtacctctacttgtgtgtgttagttt |
41958058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 267
Target Start/End: Complemental strand, 9362583 - 9362541
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggt |
267 |
Q |
| |
|
|||||||||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
9362583 |
aaattgttaggccgaatgtcatgatcggagttcgaaccccggt |
9362541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 294
Target Start/End: Complemental strand, 13538290 - 13538214
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttat |
294 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| | || ||||||| ||| ||||| |||| |||||||||||||||| |
|
|
| T |
13538290 |
aaaatatcgaaattgttaggctggacgtcatga-ccggattcgaactccgacacctccactt-tgtgtgtgagttttat |
13538214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 212 - 286
Target Start/End: Original strand, 14808855 - 14808929
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||||||| | |||||||||||| |||| ||||| | |||||||||| |||||| ||| |||| |||||||| |
|
|
| T |
14808855 |
tggcaaaatgccaaaattgttaggccggatcccatgaccagggttcgaactccggtatctccacttatgtgtgtg |
14808929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 287
Target Start/End: Complemental strand, 15208836 - 15208774
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
15208836 |
aaattattaggctggatgtcataatcggggttcgaaacttaatacctctacttatgtgtgtga |
15208774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 269
Target Start/End: Original strand, 7670386 - 7670443
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtac |
269 |
Q |
| |
|
|||||||||| |||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
7670386 |
tggcaaaatgctaaaattgttagatcggatatcatgatcggggttcgaaccccggtac |
7670443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 265
Target Start/End: Complemental strand, 13549259 - 13549206
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccg |
265 |
Q |
| |
|
|||||||||||| ||||| |||||| |||| |||||| ||||||||||||||| |
|
|
| T |
13549259 |
tggcaaaatgtcaaaatttttaggccggatatcatgacaggggttcgaaccccg |
13549206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 285
Target Start/End: Complemental strand, 13550356 - 13550284
Alignment:
| Q |
213 |
ggcaaaatgtcgaaattgttaggctggatgtcatgatc-ggggttcgaaccccggtacctctacttgtgtgtgt |
285 |
Q |
| |
|
|||||||||| || ||| ||||||||||| ||||| | |||||||||||||| ||||||| |||||||||||| |
|
|
| T |
13550356 |
ggcaaaatgttgagatttttaggctggataccatgaccgggggttcgaacccc-gtacctccacttgtgtgtgt |
13550284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 26526544 - 26526613
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| | | ||||||| || ||||||||| |||||||||| || || ||||||||||||| |
|
|
| T |
26526544 |
cgaaattgttaggccgaacgtcatgaccgaggttcgaactccggtacctccactttatgtgtgtgagttt |
26526613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 5276378 - 5276445
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| || || ||||| ||||| |||||| |||||||||| |||| |||||||||||||||||| |
|
|
| T |
5276378 |
cgaaattgctaagccggatgccatgaccggggt-cgaaccccggctcctccacttgtgtgtgtgagttt |
5276445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 10084033 - 10083957
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||| | ||| ||||||| |||||||||||| |||||| ||| || |||||||||| ||||| |
|
|
| T |
10084033 |
aaaatgtcgaaattattaagtcggacgtcatgaccggggttcgaactccggtagctccactttgtgtgtgtaagttt |
10083957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 22792214 - 22792138
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| ||| ||| ||| ||||||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
22792214 |
aaaatgccgaaattgttaggtcggacgtcttgacaggggttcgaaccccgacacctccactttgtgtgtgtgagttt |
22792138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 251 - 291
Target Start/End: Original strand, 39955752 - 39955792
Alignment:
| Q |
251 |
ggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| ||||||||||||| || |||||||||||||||||| |
|
|
| T |
39955752 |
ggggtgcgaaccccggtacttccacttgtgtgtgtgagttt |
39955792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0778 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0778
Description:
Target: scaffold0778; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 838 - 922
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
838 |
tggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttttataa |
922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 138)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 9998751 - 9998667
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| |||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9998751 |
tggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa |
9998667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 4430843 - 4430764
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4430843 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
4430764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 6317320 - 6317399
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6317320 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
6317399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 7772154 - 7772079
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7772154 |
aaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
7772079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 38953588 - 38953509
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38953588 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
38953509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 44814883 - 44814962
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44814883 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
44814962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 9569744 - 9569828
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
9569744 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgggtgtgagttttataa |
9569828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 14188110 - 14188189
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| | ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14188110 |
tggcaaaatgtcgaaattgttaggccggatgccatgacctgggttcgaaccccggtacctccacttgtgtgtgtgagttt |
14188189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 31941138 - 31941063
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
31941138 |
aaaatgccgaaattgttaggctggatgtcatgatcggggttcgaaccccgatacctccacttatgtgtgtgagttt |
31941063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 37295146 - 37295225
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37295146 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
37295225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 27817555 - 27817478
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||| | ||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27817555 |
gcaaaatgccgaaattgttagaccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
27817478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 44604930 - 44604850
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| ||||||||||||| ||||| ||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
44604930 |
ttggcaaaatgccgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacctccacttatgtgtgtgagttt |
44604850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 10096632 - 10096711
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| |||||||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
10096632 |
tggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccgatacctccacttatgtgtgtgagttt |
10096711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 19649606 - 19649527
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
19649606 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
19649527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 20993561 - 20993636
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
20993561 |
aaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttatgtgtgtgagttt |
20993636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 25063364 - 25063439
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25063364 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
25063439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 26690714 - 26690793
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
26690714 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
26690793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 287
Target Start/End: Original strand, 26737995 - 26738066
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26737995 |
aaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
26738066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 27928178 - 27928257
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||| | ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27928178 |
tggcaaaatgccgaaattgttagaccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
27928257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 211 - 286
Target Start/End: Complemental strand, 32922983 - 32922908
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
32922983 |
ttggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccagtacctccacttgtgtgtgtg |
32922908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 34540172 - 34540093
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34540172 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggtttgaatcccggtacctccacttgtgtgtgtgagttt |
34540093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 34711663 - 34711584
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34711663 |
tggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
34711584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 41562466 - 41562536
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41562466 |
aaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtg |
41562536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 5704733 - 5704657
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||| ||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
5704733 |
caaaatgtcgaaattgttaggccagatgccatgaccggggtttgaaccccggtacctccacttgtgtgtgtgagttt |
5704657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 216 - 296
Target Start/End: Original strand, 6436707 - 6436786
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| |||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
6436707 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt-cctccacttgtgtgtgtgagttttataa |
6436786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 212 - 284
Target Start/End: Complemental strand, 33067496 - 33067424
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
33067496 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaactccggtacctccacttgtgtgtg |
33067424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 40772662 - 40772594
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40772662 |
cgaaattgttaggccggatgccatgatcggggttcgaaccccggtaccttcacttgtgtgtgtgagttt |
40772594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 2733636 - 2733714
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
2733636 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacc-ccacttgtgtgtgtgagttt |
2733714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 4694795 - 4694716
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||| ||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
4694795 |
tggcaaaatgtcgaaattgttaggtcggatgtcatgaccgggattcaaaccccgctacctccacttgtgtgtgtgagttt |
4694716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 4977142 - 4977063
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4977142 |
tggcaaaatgccgaaattgttaggccggaccccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
4977063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 5895903 - 5895824
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
5895903 |
tggcaaaatgtcgaaattgttaggccgaatgctatgatcggggttcgaaccccggtacatccaattgtgtgtgtgagttt |
5895824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 10006166 - 10006245
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| |||||||||| | ||||||||||||||||||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
10006166 |
tggcaaaatgtcaaaattgttagaccggatgtcatgatcggggttcgaaccccagtaccttcacttatgtgtgtgagttt |
10006245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 11100392 - 11100317
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||||||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
11100392 |
aaaatgccgaaattgttaggccggatgccatgatcggagttcgaaccccggtacctccacttgtgtgtgtgggttt |
11100317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 14243723 - 14243798
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||| || |||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
14243723 |
aaaatgccgaaattgttaggctgaatgtcatgaccgaggttcgaaccccggtacctccatttgtgtgtgtgagttt |
14243798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 17919919 - 17919844
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||| ||||| ||||| ||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
17919919 |
aaaatgtcgatattgttaggccggatgccatgaccggggttcgaacctcggtacctccacttgtgtgtgtgagttt |
17919844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 23681030 - 23681109
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | ||||| |||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23681030 |
tggcaaaatgccaaaattattaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
23681109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 25250805 - 25250884
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||| ||||| ||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
25250805 |
tggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
25250884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 25893871 - 25893950
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||||||||||||||||||||||||||| | |||||||||| ||||| |
|
|
| T |
25893871 |
tggcaaaatgctgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccatttgtgtgtgtaagttt |
25893950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 27545024 - 27544945
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| ||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
27545024 |
tggcaaaatgtcgaaattgttaggtcggatgttatgtccggggttcgaaccccggtacctccacttgtgcgtgtgagttt |
27544945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 27849846 - 27849772
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27849846 |
aaaatgccgaaattgttaggccggatg-catgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
27849772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 36586502 - 36586581
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
36586502 |
tggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctccacttgtatgtgtgagttt |
36586581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 37817396 - 37817475
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
37817396 |
tggcaaaatgacgaaattgttaggtcggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
37817475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 38070589 - 38070510
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||| |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
38070589 |
tggcaaaatgccgaaattgttaggccggatgacatgaccgggattcgaaccacggtacctccacttgtgtgtgtgagttt |
38070510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 216 - 286
Target Start/End: Complemental strand, 24242689 - 24242619
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24242689 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
24242619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 213 - 283
Target Start/End: Complemental strand, 26732981 - 26732911
Alignment:
| Q |
213 |
ggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
26732981 |
ggcaaaatgtcgaaattgctaggtcggatgtcatgatcggggttcgaaccccagtacctccacttgtgtgt |
26732911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 217 - 291
Target Start/End: Original strand, 29513900 - 29513974
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| ||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
29513900 |
aaatgccgaaattgttaggctggataccatgattggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
29513974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 25213649 - 25213731
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||| | ||||| |||||||||||||||||||||||| |||| ||| |||||||||||||||||| |
|
|
| T |
25213649 |
tggcaaaatgccgaaattgttagaccggatgccatgatcggggttcgaaccccggtgcctccact--tgtgtgtgagttttataa |
25213731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 612504 - 612580
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||| ||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
612504 |
caaaatgccgaaattggtaggctggatgtcatgatcgggattcaaaccccgacacctctacttgtgtgtgtaagttt |
612580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 618898 - 618974
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||| ||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
618898 |
caaaatgccgaaattggtaggctggatgtcatgatcgggattcaaaccccgacacctctacttgtgtgtgtaagttt |
618974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 212 - 284
Target Start/End: Original strand, 2442782 - 2442854
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| |||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
2442782 |
tggcaaaatgtcgaaattgttaggccggatgccatgaccgggattcaaaccccggtacctccacttgtgtgtg |
2442854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 2508239 - 2508163
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| | ||||||||||| ||||||||||| |||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
2508239 |
caaaatgccaaaattgttaggacggatgtcatgaccggggttcgaactccgatacctctacttgtgtgtgtgagttt |
2508163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 3054044 - 3054127
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| | ||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
3054044 |
tggcaaaatgccgaaattgttaggccggatgccatga-ctgggttcgaaacccggtgcctccacttgtgtgtgtgagttttataa |
3054127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 36442337 - 36442405
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
36442337 |
cgaaattgttaggtcggatgtcatgattggggttcgaactccggtacctccacttgtgtgtgtgagttt |
36442405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 403690 - 403765
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
403690 |
aaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctctacttgtatgtatgagttt |
403765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 215 - 286
Target Start/End: Complemental strand, 3728431 - 3728360
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||| ||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
3728431 |
caaaatatcgaaattgttaggtcggatgtcatgattggggttcgaaccccgatacctccacttgtgtgtgtg |
3728360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 4312153 - 4312232
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| ||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
4312153 |
tggcaaaatgccgaaattgttaggtcggatgccatgactggggttcgaactccggtacctccacttgtgtgtgtgagttt |
4312232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 13634866 - 13634945
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||| |||| |||||||||| |||| ||||||||||||| |
|
|
| T |
13634866 |
tggcaaaatgccgaaattgttaggtcagatgtcatgatcggggtttgaactccggtacctccacttatgtgtgtgagttt |
13634945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 13735279 - 13735358
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||| |||| |||||||||| |||| ||||||||||||| |
|
|
| T |
13735279 |
tggcaaaatgccgaaattgttaggtcagatgtcatgatcggggtttgaactccggtacctccacttatgtgtgtgagttt |
13735358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 20150241 - 20150320
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| ||| |||||||||| |||||| |||||||||||||||||| |
|
|
| T |
20150241 |
tggcaaaatgtcaaaattgttaggccggatgtcatgaccggaattcgaaccccaatacctccacttgtgtgtgtgagttt |
20150320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 24654994 - 24655073
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||| ||||| ||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24654994 |
tggcaaaatgccaaaattgttaggccggatgccatgactggggttcgaaccccggtaccttcacttgtgtgtgtgagttt |
24655073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 25199070 - 25199145
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||| |||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25199070 |
aaaatgccgaaattgttaggccggatgctatgaccgggtttcgaaccccggtacctccacttgtgtgtgtgagttt |
25199145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 26675581 - 26675656
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| |||| |||||| ||||||| |||||| |||||||| |||||||||||||||||| |
|
|
| T |
26675581 |
aaaatgccgaaattgttaggccggatatcatgaccggggtttgaaccctggtacctccacttgtgtgtgtgagttt |
26675656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 34642545 - 34642466
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| |||||||||||| ||||||||| | |||||||||||||||| |
|
|
| T |
34642545 |
tggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaacatcggtacctcaatttgtgtgtgtgagttt |
34642466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 35421726 - 35421648
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| | ||| ||||| ||||||||||||||| ||||||| |||||||| ||||||||| |
|
|
| T |
35421726 |
tggcaaaatgtcgaaattgttaggccgaatgccatgaccggggttcgaaccccagtacctccacttgtgt-tgtgagttt |
35421648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 35497740 - 35497665
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| | |||||||||||| |||||| ||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
35497740 |
aaaatgccaaaattgttaggccggatgttatgatcggggttcaaactccggtacctccacttgtgtgtgtgagttt |
35497665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 37708555 - 37708476
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| |||| ||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
37708555 |
tggcaaaatgccgaaattgttaggacggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtaagttt |
37708476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 42922559 - 42922638
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
42922559 |
tggcaaaatgtcgaaattgtttgatcggatgtcgtgatcggggttcgaaccccggtaactccacttatgtgtgtgagttt |
42922638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 43167163 - 43167238
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||||||||||||||||||||| |||||| ||||| |||||| ||||| |
|
|
| T |
43167163 |
aaaatgtcgaaattgtaaggtttgatgtcatgatcggggttcgaaccccgatacctccacttgcgtgtgtcagttt |
43167238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 227 - 284
Target Start/End: Original strand, 16501684 - 16501741
Alignment:
| Q |
227 |
attgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16501684 |
attgttaggctggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtg |
16501741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 31639208 - 31639131
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||| |||||||||||| |||||||||| |||| |||||||| |||| |
|
|
| T |
31639208 |
gcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttatgtgtgtgggttt |
31639131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 34143460 - 34143383
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||| ||||||||| ||| ||||||||| |||| ||||||||||||| |
|
|
| T |
34143460 |
gcaaaatgccgaaattgttaggccggatgccatgaccggggttcggacctcggtacctccacttatgtgtgtgagttt |
34143383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 212 - 269
Target Start/End: Original strand, 43820888 - 43820945
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtac |
269 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
43820888 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtac |
43820945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 40344513 - 40344588
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||| | ||||||||||| |||||||||||||| |||||||| |||| ||||||||||||| |
|
|
| T |
40344513 |
caaaatgccgaaattgttagcc-ggatgtcatgaacggggttcgaaccctggtacctccacttatgtgtgtgagttt |
40344588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 5917306 - 5917381
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| | ||||||||||| |||||||| | |||||||||||||||| |
|
|
| T |
5917306 |
aaaatgtcgaaactgttaggccggatgtcatgaccagggttcgaaccatggtacctccatttgtgtgtgtgagttt |
5917381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 14725793 - 14725868
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||| |||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
14725793 |
aaaatgtcgaaattattaggccagatatcatgatcggagttcgaaccctgatacctccacttgtgtgtgtgagttt |
14725868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 17649949 - 17649871
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||||||| |||||||||||||||||| |||| || |||||||||| |
|
|
| T |
17649949 |
tggcaaaataccgaaattgttaagccggatgtcatgatcggg-ttcgaaccccggtacctccacttatgcgtgtgagttt |
17649871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 18040168 - 18040235
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||||||||| | | |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18040168 |
gaaattgttaggccggatgtcatgacccagattcgaaccccggtacctccacttgtgtgtgtgagttt |
18040235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 20662554 - 20662621
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
20662554 |
gaaattgttaggccggatgccatgaccggggttcgaatgccggtacctccacttgtgtgtgtgagttt |
20662621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 34744374 - 34744295
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||| ||||||||| ||||| |||||||| |||||||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
34744374 |
tggcaaaatgccgatattgttagggcggatgccatgatcgtggttcgaacctcggtacctccacttatgtgtgtgagttt |
34744295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 40744350 - 40744271
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| |||||||||||| |||| ||||| ||| |||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
40744350 |
tggcaaaatgtcaaaattgttaggccagatgccatgaccggagttcgaaccctagtacctccacttgtgtgtgtgagttt |
40744271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 45406347 - 45406422
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||| || ||||| | |||| |||||||| |||| |
|
|
| T |
45406347 |
aaaatgccgaaattgttaggccggatgtcatgatcggggttcgaactccagtaccaccacttatgtgtgtgggttt |
45406422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 211 - 269
Target Start/End: Complemental strand, 31261064 - 31261006
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtac |
269 |
Q |
| |
|
||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
31261064 |
ttggcaaaatgtcgaaattgttaggtcggacgccatgatcggggttcgaaccccggtac |
31261006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 211 - 272
Target Start/End: Complemental strand, 6845092 - 6845031
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctc |
272 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
6845092 |
ttggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctc |
6845031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 246 - 291
Target Start/End: Original strand, 36054025 - 36054070
Alignment:
| Q |
246 |
tgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36054025 |
tgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36054070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 8525306 - 8525230
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||| |||||||| | ||||| ||||| |||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8525306 |
caaaatgccgacattgttagaccggatgccatgactggggttcgaaccccggtatctccacttgtgtgtgtgagttt |
8525230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 284
Target Start/End: Complemental strand, 26226808 - 26226748
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||| ||||| ||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
26226808 |
gaaattgttaggccggatgccatgaccgaggttcgaaccccggtacctccacttgtgtgtg |
26226748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 279
Target Start/End: Original strand, 29158829 - 29158885
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgt |
279 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29158829 |
cgaaattgttaggccggataccatgatcggggttcgaaccccggtacctccacttgt |
29158885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 291
Target Start/End: Complemental strand, 33128261 - 33128193
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| | | ||||||||||||||||||||||||||||||| || |||||| ||||||||| |
|
|
| T |
33128261 |
gaaattgttaggccgaacgtcatgatcggggttcgaaccccggtacctccactttgtgtatgtgagttt |
33128193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 231 - 291
Target Start/End: Original strand, 36055508 - 36055568
Alignment:
| Q |
231 |
ttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||| ||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
36055508 |
ttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
36055568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 216 - 284
Target Start/End: Complemental strand, 38017278 - 38017210
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| ||||||| ||| || ||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
38017278 |
aaaatgccgaaattattaagccggatgtcatgacgggggttcgaaccccggtacctccacttgtgtgtg |
38017210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 43129127 - 43129195
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||| |||||||||| |||||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
43129127 |
cgaaattgttaggtcggatgccatgatcgggattcgaaccccggcacctccacttgtgtgtgtaagttt |
43129195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 8547238 - 8547159
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| | ||| |||||||| ||| |||||| |||| ||||||||||||| |
|
|
| T |
8547238 |
tggcaaaatgccgaaattgttaggtcggatgtcataaccggagttcgaactccgatacctccacttatgtgtgtgagttt |
8547159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 13403522 - 13403448
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| ||||||||||||||||| | ||||| | ||| ||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
13403522 |
aaaatatcgaaattgttaggctgaacgtcataaccggagttcgaaccccggtacctccactt-tgtgtgtgagttt |
13403448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 16395405 - 16395472
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
16395405 |
gaaattgttaggccggatactatgaccggggttcgaaccccggtacctccatttgtgtgtgtgagttt |
16395472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 287
Target Start/End: Complemental strand, 24241994 - 24241931
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||||| |||||| ||||||||| |||||||| |||||| ||| |||||||||||||| |
|
|
| T |
24241994 |
gaaattgttaggttggatgccatgatcggagttcgaactccggtatctccacttgtgtgtgtga |
24241931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 283
Target Start/End: Original strand, 35810257 - 35810328
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||| |||| |||||||||| |||| ||||| |
|
|
| T |
35810257 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggtttgaactccggtacctccacttttgtgt |
35810328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 287
Target Start/End: Complemental strand, 36372131 - 36372056
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||| |||||||||||||| |||| |||||| ||||||||||||||| |||||| |||| | ||||||| |
|
|
| T |
36372131 |
tggcaaaatgccgaaattgttaggccggatatcatgactggggttcgaaccccgatacctccacttatatgtgtga |
36372056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 37953807 - 37953882
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| | ||||||||||||| |||||| |||| | ||||||||||| |
|
|
| T |
37953807 |
aaaatgtcgaaattgttaggccggatgctatgattgtggttcgaaccccgatacctccacttatatgtgtgagttt |
37953882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 283
Target Start/End: Original strand, 40999777 - 40999844
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| |||| ||||||||||| |||||| |||| ||||| |
|
|
| T |
40999777 |
aaaatgtcgaaattgttaggccggatgccatgaccgggattcgaaccccgatacctccacttatgtgt |
40999844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 42650192 - 42650267
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||| |||||||||||| ||||||||| |||| ||||| ||||||| |
|
|
| T |
42650192 |
aaaatgccgaaattgttaggtcggatgccatgattggggttcgaacctcggtacctccacttatgtgtatgagttt |
42650267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 5682329 - 5682249
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacct---ctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |||| ||| |||||||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
5682329 |
gcaaaatgttgaaattgttaggccggatgttatgaccggagttcgaaccccgatacctccactaattgtgtgtgtgagttt |
5682249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 217 - 286
Target Start/End: Complemental strand, 5700752 - 5700683
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||| |||||||||||||| ||||| |||| ||||||||||||||| ||||||| |||| |||||||| |
|
|
| T |
5700752 |
aaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccagtacctccacttatgtgtgtg |
5700683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 216 - 277
Target Start/End: Complemental strand, 25899286 - 25899225
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
|||||| |||||||||||||| ||| ||||||| ||||||| ||||| |||||||||||||| |
|
|
| T |
25899286 |
aaaatgccgaaattgttaggccggacgtcatgaccggggtttgaacctcggtacctctactt |
25899225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 223 - 283
Target Start/End: Original strand, 8569976 - 8570036
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
8569976 |
cgaaattgttaggccggatgcaatgactggggttcgaaccccggtacctccacttgtgtgt |
8570036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 10617808 - 10617883
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||| |||||||||| ||||||||||| ||||||||||||||||| |||| |||||| | ||||||||| |
|
|
| T |
10617808 |
caaaatgccgacattgttaggccggatgtcatgactggggttcgaaccccggt-cctccacttgtatttgtgagttt |
10617883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 11021361 - 11021437
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||| | | ||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
11021361 |
aaaatgtcgaaattattaggtcggacgtcatgacctgagttcgaaccccggtacctccactttgtgtgtgtgagttt |
11021437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 39667000 - 39666924
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||| | ||||| ||||||| |||||| |||||||||| ||||||| |
|
|
| T |
39667000 |
caaaatgccgaaattgttaggccggatgccatgactgtggttcaaaccccgatacctccacttgtgtgtatgagttt |
39666924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 212 - 292
Target Start/End: Original strand, 41278621 - 41278701
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtttt |
292 |
Q |
| |
|
||||||||| | |||||||||||||||||| |||| || |||||||||||| |||||| |||| |||||||||||||| |
|
|
| T |
41278621 |
tggcaaaataccaaaattgttaggctggatgctatgactggagttcgaaccccgatacctccacttttgtgtgtgagtttt |
41278701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 11565032 - 11565099
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||| |||| ||| |||||||| |||||||||| |||||||||| ||||||| |
|
|
| T |
11565032 |
gaaattgttaggccggatgctatgaccggagttcgaactccggtacctccacttgtgtgtttgagttt |
11565099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 283
Target Start/End: Original strand, 35222297 - 35222364
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| || |||||||||||||||||||| |||| ||||| |
|
|
| T |
35222297 |
aaaatgtcgaaattgttaggtcggataccatgaccgaggttcgaaccccggtacctccacttatgtgt |
35222364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 38216859 - 38216784
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| |||||||||| |||||||| ||| ||| || ||| |||| ||||||||||||| |
|
|
| T |
38216859 |
aaaatgccgaaattgttaggccagatgtcatgaccggggttcaaactccgataactccacttatgtgtgtgagttt |
38216784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 225 - 291
Target Start/End: Original strand, 40216813 - 40216880
Alignment:
| Q |
225 |
aaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||| || || ||||| || |||||||||||||||| |
|
|
| T |
40216813 |
aaattgttaggccggatgtcttgatcggggttcgaatcctggcacctccactttgtgtgtgtgagttt |
40216880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 212 - 281
Target Start/End: Complemental strand, 20990521 - 20990452
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgt |
281 |
Q |
| |
|
|||||||||| ||| ||||||||| ||||||||||| | ||||||||||||| | ||||| |||||||| |
|
|
| T |
20990521 |
tggcaaaatgccgacattgttaggtcggatgtcatgaccagggttcgaaccccagaacctccacttgtgt |
20990452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 291
Target Start/End: Original strand, 21530802 - 21530879
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||| || |||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
21530802 |
gcaaaataccgaaattgttaggtcggatgccatgaccgaggttcgaatcccggtaccttcacttatgtgtgtgagttt |
21530879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 215 - 283
Target Start/End: Original strand, 22762027 - 22762096
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacct-ctacttgtgtgt |
283 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
22762027 |
caaaatgccgaaattgttaggtcggatgtcatgatcgaagttcgaacctcggtacctaccacttgtgtgt |
22762096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 250 - 291
Target Start/End: Original strand, 33286341 - 33286382
Alignment:
| Q |
250 |
cggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
33286341 |
cggggttcgaaccccggcacctccacttgtgtgtgtgagttt |
33286382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 291
Target Start/End: Complemental strand, 35058938 - 35058885
Alignment:
| Q |
238 |
ggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| |||||||||| |||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
35058938 |
ggatatcatgatcggagttcgaaccctagtacctccacttgtgtgtgtgagttt |
35058885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 11098179 - 11098103
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||| ||||||||||||||||| || | |||| | ||||||||||| |
|
|
| T |
11098179 |
caaaatatcgaaattgttaggtcgaatgtcatgactggggttcgaaccccggttccaccacttatatgtgtgagttt |
11098103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 28183815 - 28183739
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||| |||||| |||| || ||| |||||||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
28183815 |
aaaatgccgaaattattaggccggatttcttgaccggggttcgaaccccgacacctccactttgtgtgtgtgagttt |
28183739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 284
Target Start/End: Original strand, 30089983 - 30090051
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| |||||||||||| | | ||| |||||||||||||||||||| |||| | |||||||||||| |
|
|
| T |
30089983 |
aaaatgccgaaattgttagcccgaatgccatgatcggggttcgaacccaagtacatttacttgtgtgtg |
30090051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 272
Target Start/End: Complemental strand, 31665216 - 31665160
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctc |
272 |
Q |
| |
|
||||| ||||||||||||||| | | ||||||||||||||||||| | ||||||||| |
|
|
| T |
31665216 |
aaaatatcgaaattgttaggccgaacgtcatgatcggggttcgaatctcggtacctc |
31665160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 40326584 - 40326508
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||| ||| ||||||||||||||| |||||| ||| ||||| |||||||||||||||| |
|
|
| T |
40326584 |
aaaatgtgaaaattgttaggccggacgtcatgatcggggtttgaaccctagtatttctactttgtgtgtgtgagttt |
40326508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 1007151 - 1007225
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| || |||||||| | |||||||||| ||||| ||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
1007151 |
aaaatatcaaaattgttctgttggatgtcataatcggagttcgaaccccggtacctccagtt-tgtgtgtgagttt |
1007225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 3673947 - 3673872
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| || |||||||||| ||||||| | | |||||||||||||||| |
|
|
| T |
3673947 |
aaaatgtcgaaattgttaggtcatatgccatgaccgtggttcgaaccgcggtaccaccaattgtgtgtgtgagttt |
3673872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 283
Target Start/End: Complemental strand, 7432603 - 7432532
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
|||||||||| ||||||||||| | ||| |||||||||||| ||||||| | |||||||| |||| ||||| |
|
|
| T |
7432603 |
tggcaaaatgccgaaattgttaaaccggacgtcatgatcgggattcgaactctggtacctccacttatgtgt |
7432532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 10286573 - 10286494
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||| |||||||||| | | || | |||| ||| |||||||||||||| ||| |||||| ||||||||||| |
|
|
| T |
10286573 |
tggcaaaatgtcaaaattgttagaccgaataccgtgattgggattcgaaccccggtatctccacttgtatgtgtgagttt |
10286494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 287
Target Start/End: Original strand, 23554894 - 23554965
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||| |||||||||||| | ||||||||||| ||||||| |||| |||||||| ||||||| |||||| |
|
|
| T |
23554894 |
aaaatgccgaaattgttagatcgaatgtcatgatcagggttcggaccctggtacctccacttgtgcgtgtga |
23554965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 263
Target Start/End: Complemental strand, 29845188 - 29845142
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccc |
263 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
29845188 |
aaaatatcgaaattgttaggc-ggatgccatgatcggggttcgaaccc |
29845142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 215 - 285
Target Start/End: Complemental strand, 11265161 - 11265091
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgt |
285 |
Q |
| |
|
||||||||| |||||||||||| ||||| | ||||||| ||| ||| |||||||||| |||| ||||||| |
|
|
| T |
11265161 |
caaaatgtcaaaattgttaggccggatgccgtgatcggaattcaaactccggtacctccacttatgtgtgt |
11265091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 277
Target Start/End: Complemental strand, 11109961 - 11109900
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
|||||| | ||||||||| |||||| ||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
11109961 |
aaaatgccaaaattgttaagctggacgtcatgactggggttcgaaccccggtatctccactt |
11109900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 257
Target Start/End: Original strand, 14725328 - 14725369
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttc |
257 |
Q |
| |
|
||||||||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
14725328 |
aaaatgtcgaaattgttaggccgtatgttatgatcggggttc |
14725369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 261
Target Start/End: Original strand, 31291243 - 31291288
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaac |
261 |
Q |
| |
|
|||||| |||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
31291243 |
aaaatgccgaaattgttaggccgaacgtcatgatcggggttcgaac |
31291288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 261
Target Start/End: Complemental strand, 36482160 - 36482115
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaac |
261 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
36482160 |
aaaatgtcgaaattgttaggccgaatgctatgatcggggttcgaac |
36482115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 261
Target Start/End: Complemental strand, 37821010 - 37820965
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaac |
261 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
37821010 |
aaaatgtcaaaattgttaggttggacgtcatgatcggggtttgaac |
37820965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 12321011 - 12321087
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||| | | |||| || | | |||||||||||| ||||||||| ||||| |||||||||| |
|
|
| T |
12321011 |
aaaatgtcaaaattgttaggccgaacgtcacgaccagagttcgaaccccgatacctctactttgtgcgtgtgagttt |
12321087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 211 - 283
Target Start/End: Complemental strand, 12927335 - 12927263
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
||||||||||| |||||||||| || | | | ||||||| |||||||||| ||||||| || |||||||||| |
|
|
| T |
12927335 |
ttggcaaaatgctgaaattgttatgccgtacgccatgatcagggttcgaactccggtacatccacttgtgtgt |
12927263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 40418160 - 40418228
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| || ||||||| ||| |||||||||||| |||||| || || ||||||||||||| |
|
|
| T |
40418160 |
gaaattgttaggccagacgtcatgaccggagttcgaaccccgatacctccactttatgtgtgtgagttt |
40418228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 41897855 - 41897923
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| ||||||||| | ||| ||| ||||||| ||| || |||| ||||||||||||| |
|
|
| T |
41897855 |
cgaaattgttaggccggatgtcataactgggattcaaaccccgatacttccacttatgtgtgtgagttt |
41897923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 123)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 10635509 - 10635593
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10635509 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa |
10635593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 13555832 - 13555748
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13555832 |
tggcaaaatgccgaaattattaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa |
13555748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 34010114 - 34010193
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
34010114 |
tggcaaaatgtcgaaattgttaggccggatgccatgatcggggtttgaaccccggtacctccacttgtgtgtgtgagttt |
34010193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 43086579 - 43086500
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43086579 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
43086500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 49500881 - 49500960
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49500881 |
tggcaaaatgccgaaattgttaggccggatgtcatgatcgaggttcgaaccccggtacctccacttgtgtgtgtgagttt |
49500960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 214 - 291
Target Start/End: Original strand, 27078570 - 27078647
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
27078570 |
gcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
27078647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 15952940 - 15952856
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
15952940 |
tggcaaaatgccgaaattgttaggtcggatgttatgatcggggttcgaactccggtacctccacttgtgtgtgtgagttttataa |
15952856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 19338286 - 19338207
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19338286 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
19338207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 20164181 - 20164102
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20164181 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
20164102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 29005110 - 29005189
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29005110 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
29005189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 36586275 - 36586350
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36586275 |
aaaatgtcgaaattgttaggccggatgccgtgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36586350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 41445138 - 41445059
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||| |||||||||| ||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41445138 |
tggcaaaatgccgacattgttaggccggatgtcatgatcggagttcgaaccccggtacctccacttgtgtgtgtgagttt |
41445059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 42631093 - 42631014
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
42631093 |
tggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
42631014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 287
Target Start/End: Original strand, 48314187 - 48314262
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48314187 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
48314262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 13980415 - 13980335
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
13980415 |
ttggcaaaatgtcgaaattgttaggtcggatatcatgatcggggttcgaatcccggtacctccacttatgtgtgtgagttt |
13980335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 15104067 - 15104143
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
15104067 |
caaaatgccaaaattgttaggccggatgtcatgatcggggttcgaaccccgatacctctacttatgtgtgtgagttt |
15104143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 48731861 - 48731785
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48731861 |
caaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
48731785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 17068176 - 17068251
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17068176 |
aaaatgccgaaattgttaggccggatgccatgagcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
17068251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 24254514 - 24254440
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
24254514 |
aaaatgtcgaaattgttaggctagatgtcatgatcggggttcgaaccccagta-ctccacttgtgtgtgtgagttt |
24254440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 25821054 - 25820979
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| |||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
25821054 |
aaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
25820979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 40958682 - 40958603
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
40958682 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtgtgagttt |
40958603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 43676132 - 43676053
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43676132 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttgtgtgtgtgagttt |
43676053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 49632579 - 49632654
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| || ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
49632579 |
aaaatgccgaaattgttaggctggatgtcatgaccgaggttcgaaccccgatacctccacttgtgtgtgtgagttt |
49632654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 49948261 - 49948340
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| |||| |||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
49948261 |
tggcaaaatgtcgaaattgttaggccggatgccatgaccgggattcgaaccccagtacctccacttgtgtgtgtgagttt |
49948340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 50248053 - 50248128
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
50248053 |
aaaatgtcgaaattgttaggccggatgtcatgaccgaggttcgaaccccgatacctccacttgtgtgtgtgagttt |
50248128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 47429698 - 47429621
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
47429698 |
gcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaatcccggtacctccacttatgtgtgtgagttt |
47429621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 4126598 - 4126674
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4126598 |
caaaatgcggaaattgttaggccggatgccatgatcagggttcgaaccccggtacctccacttgtgtgtgtgagttt |
4126674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 18089873 - 18089798
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
18089873 |
caaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgt-tgtgagttt |
18089798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 21522336 - 21522416
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| || ||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21522336 |
ttggcaaagtgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
21522416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 5598325 - 5598400
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| ||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5598325 |
aaaatgccgaaattgttaggtcggatgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtgagttt |
5598400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 13048911 - 13048836
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
13048911 |
aaaatatcgaaattgttaggccggatgtcatgatcggagttcgaaccccggtacctccatttatgtgtgtgagttt |
13048836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 13053908 - 13053833
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
13053908 |
aaaatatcgaaattgttaggccggatgtcatgatcggagttcgaaccccggtacctccatttatgtgtgtgagttt |
13053833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 18216368 - 18216443
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
18216368 |
aaaatgccgaaattgttaggccggatgccatgatcggggttcaaactccggtacctccacttgtgtgtgtgagttt |
18216443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 24119676 - 24119755
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||||||| |||| ||| |||| ||||||||||||| |
|
|
| T |
24119676 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccctggtatctccacttatgtgtgtgagttt |
24119755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 32880687 - 32880608
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
32880687 |
tggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccgctacctccacttgtgtgtgtgagttt |
32880608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 33845712 - 33845633
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||||||| ||| ||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
33845712 |
tggcaaaatgccgaaattgttagaccggatgtcatgaccggagttcgaaccccggtacctccaattgtgtgtgtgagttt |
33845633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 33948266 - 33948345
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||||||| ||| ||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
33948266 |
tggcaaaatgccgaaattgttagaccggatgtcatgaccggagttcgaaccccggtacctccaattgtgtgtgtgagttt |
33948345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 48391976 - 48392055
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| | ||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
48391976 |
tggcaaaatgccgaaattgttaggccggatgccatgaccagggttcgaaccccggtacctccacttatgtgtgtgagttt |
48392055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 217 - 291
Target Start/End: Original strand, 27856022 - 27856096
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
27856022 |
aaatgccgaaattgttaggccagatgtcatgatcggggttcgaatcccggtacttccacttgtgtgtgtgagttt |
27856096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 212 - 285
Target Start/End: Complemental strand, 3840470 - 3840398
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||| ||||||||||| |
|
|
| T |
3840470 |
tggcaaaatgtcgaaattgttaggctggatgtcatgat-ggggttcgaatctcggtacctcctcttgtgtgtgt |
3840398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 15906273 - 15906196
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||||||| ||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
15906273 |
gcaaaatgccgaaattgttaggccagatgccatgatcagggttcgaaccccggtacctccacttatgtgtgtgagttt |
15906196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 218 - 291
Target Start/End: Complemental strand, 29803275 - 29803202
Alignment:
| Q |
218 |
aatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
29803275 |
aatgccgaaattgttaggccagatgccatgatcggggttcgaaccccggtacatccacttgtgtgtgtgagttt |
29803202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 216 - 284
Target Start/End: Complemental strand, 270425 - 270357
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
270425 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtg |
270357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 296
Target Start/End: Original strand, 11786135 - 11786207
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
||||||||||||| |||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11786135 |
gaaattgttaggccggatgtcatggctggggttcaaaccccggtacctccacttgtgtgtgtgagttttataa |
11786207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 279
Target Start/End: Complemental strand, 21897786 - 21897722
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |||||| |
|
|
| T |
21897786 |
caaaatgtcgaaattgttaggctggatgctatgatcggggttcgaactccggtacctccacttgt |
21897722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 23809989 - 23809913
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| |||||||| ||| |||||| |||| ||||||||||||| |
|
|
| T |
23809989 |
caaaatatcgaaattgttaggccggatgtcatgatcggagttcgaactccgatacctccacttatgtgtgtgagttt |
23809913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 35758306 - 35758374
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
35758306 |
cgaaattgttaggctcgatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
35758374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 36018901 - 36018977
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| || || | ||| || |||||||||||||||||| |
|
|
| T |
36018901 |
caaaatgtcgaaattgttaggccggatgtcatgatcggggttcaaatcctgatacttccacttgtgtgtgtgagttt |
36018977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 37771088 - 37771168
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| |||||||||||||||||| |||||||||| | |||||| ||||||||| |
|
|
| T |
37771088 |
ttggtaaaatgtcgaaattgttaggccggatatcatgatcggggttcgaattccggtacctccatttgtgtatgtgagttt |
37771168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 40962807 - 40962731
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| | ||||| |||||||||||| |||||||||||||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
40962807 |
caaaatgccaaaattattaggctggatgccatgatcggggttcgaaccccgatacctccacttatgtgtgtgagttt |
40962731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 227 - 291
Target Start/End: Complemental strand, 52155351 - 52155287
Alignment:
| Q |
227 |
attgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
52155351 |
attgttaggctggatgccatgaccggggttcgaaccccagtacctccacttgtgtgtgtgagttt |
52155287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 3315814 - 3315893
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||| |||||||||| ||||| ||||| | || |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3315814 |
tggcaaaatgccgacattgttaggccggatgccatgaccaggattcgaaccccggtacctccacttgtgtgtgtgagttt |
3315893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 11403193 - 11403268
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||||||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
11403193 |
aaaatgccgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacatccatttgtgtgtgtgagttt |
11403268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 23225394 - 23225319
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23225394 |
aaaatgtcaaaattgttaggtcggatgccatgacaggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
23225319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 39606429 - 39606504
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||| |||||||||| ||||| ||||| |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
39606429 |
aaaatgccgatattgttaggccggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
39606504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 40685549 - 40685628
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||| ||| |||||| | ||||||||| |||||| |
|
|
| T |
40685549 |
tggcaaaatgtcgaaattgttaggtcggatgtcatgaccggggttcgaactccgatacctccatttgtgtgtgagagttt |
40685628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 52492785 - 52492710
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| ||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
52492785 |
aaaatgttgaaattgttaggccggatgtcatgattggggttcgaaccccggtttcttcacttgtgtgtgtgagttt |
52492710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 212 - 281
Target Start/End: Original strand, 5790078 - 5790147
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgt |
281 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||| |||| |||||| |||||||| |
|
|
| T |
5790078 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaatcccgatacctccacttgtgt |
5790147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 216 - 285
Target Start/End: Complemental strand, 26261397 - 26261328
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgt |
285 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
26261397 |
aaaatgccgaaattgttaggccggataccatgatcggggttcgaatcccggtacctccacttgtgtgtgt |
26261328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 212 - 292
Target Start/End: Complemental strand, 11797507 - 11797427
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtttt |
292 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||| |||| ||||||| |||||||| |||| |||||||||||||| |
|
|
| T |
11797507 |
tggcaaaatgtcgaaattgttaggccgaatgtcatgaccgggattcgaacattggtacctccacttatgtgtgtgagtttt |
11797427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 216 - 284
Target Start/End: Original strand, 40241512 - 40241580
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| ||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
40241512 |
aaaatgtcgaaattgttaggccggatatcatgaccggagttcgaacctcggtacctccacttgtgtgtg |
40241580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 271
Target Start/End: Original strand, 236594 - 236649
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacct |
271 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
236594 |
aaaatgtcgaaattgttaggccggacgtcatgaccggggttcgaaccccggtacct |
236649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 10430443 - 10430368
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||| ||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
10430443 |
aaaatgccgaaattgttaggccggatgcaatgactggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
10430368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 13018093 - 13018172
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| || |||||||||||| | ||||| ||||| ||||||||||||||||||||||| |||||| ||||| ||||| |
|
|
| T |
13018093 |
tggcaaagtgccgaaattgttagaccggatgccatgaccggggttcgaaccccggtacctccacttgtatgtgtcagttt |
13018172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 15331166 - 15331091
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||| || |||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
15331166 |
aaaatgccgaaattgttaggtcggatgccatgaccgaggttcgaaccccggtacctccacttgtgtatgtgagttt |
15331091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 40809321 - 40809247
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
40809321 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggt-----ccccggtacctccacttgtgtgtgtgagttt |
40809247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 212 - 290
Target Start/End: Original strand, 9705547 - 9705625
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtt |
290 |
Q |
| |
|
|||||||||| | |||||||||||| ||||| ||||| ||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
9705547 |
tggcaaaatgccaaaattgttaggccggatgccatgactggggttcgaaccccggtttctccacttgtgtgtgtgagtt |
9705625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 238 - 288
Target Start/End: Complemental strand, 25083204 - 25083154
Alignment:
| Q |
238 |
ggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgag |
288 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25083204 |
ggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgag |
25083154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 214 - 284
Target Start/End: Original strand, 46850986 - 46851056
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| |||||||||| |||||| ||| ||||||||||| |
|
|
| T |
46850986 |
gcaaaatgtcgaaattgttaggtcggatgccatgatccgggttcgaactccggtatctccacttgtgtgtg |
46851056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 35010695 - 35010618
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||| || |||||||||||| |||||| |||| | | ||||||||| |
|
|
| T |
35010695 |
gcaaaatgccgaaattgttaggctggatgccatgattggagttcgaaccccgatacctccacttatatatgtgagttt |
35010618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 214 - 291
Target Start/End: Complemental strand, 46561341 - 46561264
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| | |||||||||| | ||||| |||||||||||||||||| ||| |||||| ||||| |||||||||||| |
|
|
| T |
46561341 |
gcaaaatgccaaaattgttagtccggatgccatgatcggggttcgaactccgttacctccacttgcgtgtgtgagttt |
46561264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 8194059 - 8193991
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||||||||||||| ||||||| |||| ||||||||||||| |
|
|
| T |
8194059 |
cgaaattgttaggcctgatgccatgaccggggttcgaacccctgtacctccacttatgtgtgtgagttt |
8193991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 8312632 - 8312556
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| | | || ||||||| |||||||||||||||||||| || ||||||| |||||||| |
|
|
| T |
8312632 |
aaaatgtcgaaattgttaggccgaacgttatgatcgaggttcgaaccccggtacctccactttgtgtgagtgagttt |
8312556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 12502732 - 12502800
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||| |||||||| ||||||||||| |||||||||| || |||||||||||||||| |
|
|
| T |
12502732 |
gaaattgttaggccggacgtcatgattggggttcgaactccggtacctcaactttgtgtgtgtgagttt |
12502800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 13116950 - 13117026
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| | ||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
13116950 |
aaaatgtcgaaattgttaggctggacgtcatgaccaaggttcgaactccggtaccttcactttgtgtgtgtgagttt |
13117026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 29511127 - 29511207
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| |||||| |||||||||||||| | ||||||||| |||||||||||||||| |||||| | || ||||| ||||||| |
|
|
| T |
29511127 |
ttggtaaaatgacgaaattgttaggccgaatgtcatgaccggggttcgaaccccgatacctccatttatgtgtatgagttt |
29511207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 37315158 - 37315082
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||| | ||||||||| ||| ||||| || |||||||||||||||| |
|
|
| T |
37315158 |
aaaatgccgaaattgttaggctggacgtcatgatccgagttcgaacctcggaacctccactttgtgtgtgtgagttt |
37315082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 45007800 - 45007721
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| ||||| ||||||||||||||| ||||||||||| || |||||||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
45007800 |
ttggtaaaatatcgaaattgttaggccggatgtcatgaccgaggttcgaaccccagtacctc-ccttatgtgtgtgagttt |
45007721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 291
Target Start/End: Original strand, 45788654 - 45788722
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| || | ||| |||||||||||||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
45788654 |
cgaaattgttaagccgaatgccatgatcggggttcgaaccccgatacctccacttctgtgtgtgagttt |
45788722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 5511807 - 5511882
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||| ||||||||||| ||||||||| | || ||| ||||||||| |
|
|
| T |
5511807 |
aaaatgtcgaaattgttaggctgaatgccatgattggggttcgaacttcggtacctccatttatgtatgtgagttt |
5511882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 220 - 291
Target Start/End: Original strand, 12282643 - 12282713
Alignment:
| Q |
220 |
tgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||| | ||||||||| |||| ||||||| ||||| |
|
|
| T |
12282643 |
tgtcgaaattgttaggctggatgccatgaccggggttcgaa-ctcggtacctccacttatgtgtgtaagttt |
12282713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 16689106 - 16689185
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||| |||||||| ||||| ||| ||| ||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
16689106 |
tggcaaaatatcgaaatttttaggtcggacgtcttgatcggggttcgaaccccaacacctcaacttgtgtgtgtgagttt |
16689185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 39522866 - 39522787
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||| |||||||||||||| ||||||| || || ||||| ||||||||| |
|
|
| T |
39522866 |
tggcaaaatgcagaaattgttaggccggatgccattatcggggttcgaactccggtacatccacctgtgtatgtgagttt |
39522787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 39787754 - 39787679
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||| | | ||| ||||| |||||||||||| |||||||||| |||| | ||||||||||| |
|
|
| T |
39787754 |
aaaatgtcgaaattgttagaccgaatgccatgaccggggttcgaactccggtacctccacttatatgtgtgagttt |
39787679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 271
Target Start/End: Original strand, 41651097 - 41651152
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacct |
271 |
Q |
| |
|
|||||| ||||||||||||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
41651097 |
aaaatgccgaaattgttaggttggacgtcatgatcggggttcgaatcccggtacct |
41651152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 50145236 - 50145161
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| | |||||||||| ||||||||||| ||| ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
50145236 |
aaaatgtcaatattgttaggccggatgtcatgactgggattcgaaccccgataccttcacttgtgtgtgtgagttt |
50145161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 215 - 285
Target Start/End: Original strand, 5322615 - 5322685
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgt |
285 |
Q |
| |
|
||||||| |||||||||||||||||| |||||| |||||||||||||||| ||| | |||||||||||| |
|
|
| T |
5322615 |
caaaatgctgaaattgttaggctggatatcatgaccggggttcgaaccccgatacgttcacttgtgtgtgt |
5322685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 215 - 289
Target Start/End: Original strand, 40503620 - 40503694
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagt |
289 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| |||||||| || |||| ||| |||| ||||||||||| |
|
|
| T |
40503620 |
caaaatgttgaaattgttaggccggatgtcatgatcaaggttcgaatcctggtaactccacttatgtgtgtgagt |
40503694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 214 - 291
Target Start/End: Original strand, 2112769 - 2112846
Alignment:
| Q |
214 |
gcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| ||||| |||||| ||| ||||||| |||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
2112769 |
gcaaaatgatgaaatcgttaggtcggacgtcatgaccggggttcgaacccatgtacctccacttgtgtgtgtgagttt |
2112846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 8793279 - 8793203
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| || ||||||||| || | | ||||||| ||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
8793279 |
aaaatatcaaaattgttaagccgtacgtcatgaccggggttcgaaccccggtacctccactttgtgtgtgtgagttt |
8793203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 251 - 291
Target Start/End: Complemental strand, 15324523 - 15324483
Alignment:
| Q |
251 |
ggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15324523 |
ggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
15324483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 29510756 - 29510680
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| | |||||||||| ||||||||||| ||||||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
29510756 |
caaaatgccaaaattgttagatcggatgtcatgaccggggttcgaaccttggtacttccacttgtgtgtgtgagttt |
29510680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 215 - 291
Target Start/End: Complemental strand, 44623123 - 44623047
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| || ||||||||| || |||||||||||||||||||||||| |||||| || |||| ||| ||||||||| |
|
|
| T |
44623123 |
caaaatatcaaaattgttaagccggatgtcatgatcggggttcgaacttcggtacttccacttatgtatgtgagttt |
44623047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 8050506 - 8050581
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| | |||| |||| |||||||| || ||||||||||||||| ||| | ||||||| |
|
|
| T |
8050506 |
aaaatgtcgaaattgttaggccgaatgttatgaccggggttcaaattccggtacctctacttatgtatatgagttt |
8050581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 220 - 291
Target Start/End: Original strand, 11942559 - 11942630
Alignment:
| Q |
220 |
tgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||| | || ||||||||||||||||| |||||| ||| ||||||||||| |||||| |
|
|
| T |
11942559 |
tgtcgaaattgttaggccgaatactatgatcggggttcgaactccggtatctccacttgtgtgtgagagttt |
11942630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 290
Target Start/End: Complemental strand, 16084330 - 16084263
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtt |
290 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| ||||||| ||||| |||| |||||||||||| |
|
|
| T |
16084330 |
cgaaattgttaggccggatgccatgatcggggtttgaaccccaataccttcacttatgtgtgtgagtt |
16084263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 32533847 - 32533926
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| | |||||||||||| | ||| ||| ||||| |||||||| | |||||||| |||| ||||||||||||| |
|
|
| T |
32533847 |
tggcaaaatgccaaaattgttaggccgaatgccataatcggagttcgaactctggtacctccacttatgtgtgtgagttt |
32533926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 283
Target Start/End: Original strand, 39467044 - 39467115
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
|||||||||| |||||||||||| |||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39467044 |
tggcaaaatggtaaaattgttaggccagatgctatgatcggggttcgaaccccggtaccttcacttgtgtgt |
39467115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 287
Target Start/End: Complemental strand, 40326824 - 40326754
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||| |||||||||||||| |||||| |||||||| |||||||||||| ||||| | |||||||||||| |
|
|
| T |
40326824 |
aaaatgccgaaattgttaggc-ggatgttatgatcggagttcgaaccccgataccttcatttgtgtgtgtga |
40326754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 43500247 - 43500172
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||| ||| | |||||||| | |||||| ||||||||| |
|
|
| T |
43500247 |
aaaatgtcgaaattgttaggtcggatgctatgatcggggttcaaactctggtacctccatttgtgtatgtgagttt |
43500172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 212 - 270
Target Start/End: Original strand, 18475129 - 18475187
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacc |
270 |
Q |
| |
|
||||||||| ||| |||||||||| ||||| |||||||||||||||||||| |||||| |
|
|
| T |
18475129 |
tggcaaaataccgacattgttaggccggatgccatgatcggggttcgaaccctggtacc |
18475187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 22332181 - 22332251
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||| | |||||||| |||| |||||||| |
|
|
| T |
22332181 |
aaaatgtcgaaattgttaggccagatgttatgatcggagttcgaatcatggtacctccacttatgtgtgtg |
22332251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 277
Target Start/End: Complemental strand, 17540180 - 17540119
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
|||||| |||||||||||||| || ||||||| |||||||||||||||| |||||| |||| |
|
|
| T |
17540180 |
aaaatgccgaaattgttaggccagacgtcatgaccggggttcgaaccccgatacctcaactt |
17540119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 277
Target Start/End: Complemental strand, 44836222 - 44836161
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
||||| || ||||||||||| ||| ||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
44836222 |
aaaatatcaaaattgttaggtcggacgtcatgatcggggttcgaaccccggtatctccactt |
44836161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 2735810 - 2735890
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| |||||||||| | ||| ||||||| || |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
2735810 |
ttggcaaaatgcagaaattgttaagtaggacgtcatgaccgttgttcgaaccccgacacctccacttgtgtgtgtgagttt |
2735890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 7204612 - 7204536
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| | | |||||| |||||||||||||||| |||||| || |||||| ||||||||| |
|
|
| T |
7204612 |
aaaatgccgaaattgttaggccgaacatcatgaccggggttcgaaccccgatacctccactttgtgtatgtgagttt |
7204536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 296
Target Start/End: Complemental strand, 13874235 - 13874163
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||||| ||||| |||||||| || ||||| |||||||||| | |||| |||||||||||||||| |
|
|
| T |
13874235 |
gaaattgttaggtcggatgatatgatcggtgtgcgaactccggtacctccatttgtatgtgtgagttttataa |
13874163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 243 - 291
Target Start/End: Complemental strand, 51263890 - 51263842
Alignment:
| Q |
243 |
tcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
51263890 |
tcatgaccggggttcgaactccggtacctccacttatgtgtgtgagttt |
51263842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 13948128 - 13948202
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| |||||||||||||| |||| |||||||||||||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
13948128 |
aaaatatcgaaattgttaggtcagatgctatgatcggggttcgaaccccggcgcctccacttgt-tgtgtgagttt |
13948202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 26763448 - 26763373
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||| ||| |||| || ||||||||||||| | || |||| ||||||||||||||||| |
|
|
| T |
26763448 |
aaaatgccgaaattgttaggtcggacgtcacgaccggggttcgaacctctgtgcctccgcttgtgtgtgtgagttt |
26763373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 287
Target Start/End: Original strand, 28565145 - 28565216
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
||||||||| ||||||||| ||| ||| ||||| | | ||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
28565145 |
aaaatgtcgtaattgttagactgaatgccatgaccagagtttgaaccccgatacctctacttatgtgtgtga |
28565216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 48474744 - 48474819
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||| |||| |||||| ||||| ||||||||| |||||| |||| |||| | ||||||||||| |
|
|
| T |
48474744 |
aaaatgtcgaaattgataggttggatgccatgactagggttcgaatcccggttcctccacttatatgtgtgagttt |
48474819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 215 - 281
Target Start/End: Original strand, 43025909 - 43025975
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgt |
281 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||||| | |||||||||| | ||||||| |||||||| |
|
|
| T |
43025909 |
caaaatatcgaaattgttaggccggatgccatgacctgggttcgaacttcagtacctccacttgtgt |
43025975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 274
Target Start/End: Complemental strand, 45751131 - 45751073
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctcta |
274 |
Q |
| |
|
|||||| ||||||||||||| | | ||||| ||||||||| ||||||||||||||||| |
|
|
| T |
45751131 |
aaaatgccgaaattgttaggttatacgtcataatcggggttagaaccccggtacctcta |
45751073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 217 - 291
Target Start/End: Original strand, 48302309 - 48302383
Alignment:
| Q |
217 |
aaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| ||||||||||| || | || ||||| ||||||||||| ||| ||||||| |||| ||||||||||||| |
|
|
| T |
48302309 |
aaatgccgaaattgttaagccgaataccatgaccggggttcgaatcccagtacctccacttatgtgtgtgagttt |
48302383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 291
Target Start/End: Original strand, 1576420 - 1576473
Alignment:
| Q |
238 |
ggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| ||||| |||||||||||| ||| |||||| |||| ||||||||||||| |
|
|
| T |
1576420 |
ggatgccatgaccggggttcgaactccgttacctccacttatgtgtgtgagttt |
1576473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 3628679 - 3628758
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctgg--atgtcatgatcggggttcgaaccccggtacctctac--ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| || | ||| |||||||||||||||| |||| ||||| || |||||||||||||||| |
|
|
| T |
3628679 |
aaaatgccgaaattgttaggcgggggacgtcttgatcggggttcgaactccggcacctccacctttgtgtgtgtgagttt |
3628758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 291
Target Start/End: Original strand, 6669368 - 6669405
Alignment:
| Q |
254 |
gttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
6669368 |
gttcgaaccccggtacctccacttatgtgtgtgagttt |
6669405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 291
Target Start/End: Complemental strand, 22561224 - 22561187
Alignment:
| Q |
254 |
gttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
22561224 |
gttcaaaccccggtacctccacttgtgtgtgtgagttt |
22561187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 243 - 291
Target Start/End: Original strand, 50905485 - 50905534
Alignment:
| Q |
243 |
tcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| || ||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
50905485 |
tcatgattggagttcgaacctcggtacctctactttgtgtgtgtgagttt |
50905534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 252
Target Start/End: Original strand, 30455228 - 30455264
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcgg |
252 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
30455228 |
aaaatgtcgaaattgttaggccggatgccatgatcgg |
30455264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 37186921 - 37186845
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||| || ||| ||||||| | |||||||||| | |||||||| || |||||||| ||||||| |
|
|
| T |
37186921 |
aaaatgccgaaattgttaagccggacgtcatgaccagggttcgaactctggtacctccactttgtgtgtttgagttt |
37186845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 49773558 - 49773482
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||| ||||||||||||| | | ||||| | | | |||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
49773558 |
aaaatgttgaaattgttaggccgaacgtcataaccagagttcgaaccccgatacctctactttgtgtgtgtaagttt |
49773482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 90589 - 90668
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
90589 |
tggcaaaatgccgaaattgttaggcctgatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
90668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 9387 - 9471
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
9387 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttttataa |
9471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0402 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0402
Description:
Target: scaffold0402; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 1349 - 1270
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1349 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
1270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0595 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0595
Description:
Target: scaffold0595; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Original strand, 365 - 444
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
365 |
tggcaatatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0287 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0287
Description:
Target: scaffold0287; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 1166 - 1087
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||| |||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
1166 |
tggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
1087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 8967 - 8888
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| || ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8967 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccgaggttcgaaccccggtaccttcacttgtgtgtgtgagttt |
8888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 39417 - 39342
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39417 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
39342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0515 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0515
Description:
Target: scaffold0515; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 2501 - 2577
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
2501 |
caaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
2577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0306 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0306
Description:
Target: scaffold0306; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 291
Target Start/End: Original strand, 2501 - 2577
Alignment:
| Q |
215 |
caaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
2501 |
caaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttatgtgtgtgagttt |
2577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0244 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0244
Description:
Target: scaffold0244; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 211 - 291
Target Start/End: Complemental strand, 7866 - 7786
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
7866 |
ttggcaaaatgccgaaattgttagatcggatgtcatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagttt |
7786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 216 - 296
Target Start/End: Original strand, 160472 - 160552
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||| |||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
160472 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgccttcacttgtgtgtgtgagttttataa |
160552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 411668 - 411751
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||| ||||||||||||||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
411668 |
tggcaaaatgtcaaaattgttaggtcggatgtcatgaccggggttcgaaccccagtacctccacttgtgtgtgtga-ttttataa |
411751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0457 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: scaffold0457
Description:
Target: scaffold0457; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 212 - 287
Target Start/End: Original strand, 6799 - 6874
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtga |
287 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||||| |||||||||| |||| ||||||||| |
|
|
| T |
6799 |
tggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaactccggtacctccacttatgtgtgtga |
6874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 195765 - 195840
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| ||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
195765 |
aaaatgtcgaaattgttaggccggatttcatgactggggttcgaaccccggttcctccacttgtgtgtgtgagttt |
195840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 212 - 296
Target Start/End: Complemental strand, 4123 - 4039
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| ||||||||||| || ||||| ||||| ||||||||||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
4123 |
tggcaaaatgccgaaattgttaagccggatgccatgactggggttcgaaccccggtgcctccacttgtgtgtgtaagttttataa |
4039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 213 - 284
Target Start/End: Original strand, 42073 - 42144
Alignment:
| Q |
213 |
ggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtg |
284 |
Q |
| |
|
||||||||| | |||||||||||| ||| | ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42073 |
ggcaaaatgccaaaattgttaggccggacgccatgatcggggttcgaaccccggtatctctacttgtgtgtg |
42144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0882 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0882
Description:
Target: scaffold0882; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 3805 - 3726
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||| ||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
3805 |
tggcaaaatgccgaaattgttaggccggatgctatgactggggttcgaacccttgtacctccacttgtgtgtgtgagttt |
3726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0548 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0548
Description:
Target: scaffold0548; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 216 - 283
Target Start/End: Original strand, 6772 - 6838
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgt |
283 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
6772 |
aaaatgccgaaattgttaggccggatgtcatga-cggggttcgaactccggtacctccacttgtgtgt |
6838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0163 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0163
Description:
Target: scaffold0163; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 291
Target Start/End: Complemental strand, 5580 - 5501
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||| |||| ||||||||||| | ||||||||||||||||||| |||||| | |||||| |||||||||||||||||| |
|
|
| T |
5580 |
tggcagaatgccgaaattgttatgtcggatgtcatgatcggggtttgaaccctgatacctccacttgtgtgtgtgagttt |
5501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 64315 - 64382
Alignment:
| Q |
224 |
gaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
||||||||||||| ||||| ||||| ||| ||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
64315 |
gaaattgttaggccggatgccatgaccggagttcgaaccccagtacctccacttgtgtgtgtgagttt |
64382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 216 - 284
Target Start/End: Complemental strand, 93072 - 93003
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacct-ctacttgtgtgtg |
284 |
Q |
| |
|
|||||| ||||||| |||||||||||| ||||| |||||||||||||||||||||| | ||||||||||| |
|
|
| T |
93072 |
aaaatgccgaaattattaggctggatgccatgaccggggttcgaaccccggtacctcccacttgtgtgtg |
93003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0633 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0633
Description:
Target: scaffold0633; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 216 - 271
Target Start/End: Complemental strand, 3899 - 3844
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacct |
271 |
Q |
| |
|
|||||| ||||||||||||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
3899 |
aaaatgccgaaattgttaggttggacgtcatgatcggggttcgaatcccggtacct |
3844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0502 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0502
Description:
Target: scaffold0502; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 245 - 291
Target Start/End: Original strand, 10568 - 10614
Alignment:
| Q |
245 |
atgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10568 |
atgatcagggttcgaaccccggtacctccacttgtgtgtgtgagttt |
10614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0242
Description:
Target: scaffold0242; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 15082 - 15152
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||| || |||||||||| | ||||||| ||||||||||||| |
|
|
| T |
15082 |
aaaatgccgaaattgttaggccgaatgtcatgaccgaggttcgaacctctgtacctccacttgtgtgtgtg |
15152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 23917 - 23987
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
286 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||| || |||||||||| | ||||||| ||||||||||||| |
|
|
| T |
23917 |
aaaatgccgaaattgttaggccgaatgtcatgaccgaggttcgaacctctgtacctccacttgtgtgtgtg |
23987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 223 - 281
Target Start/End: Complemental strand, 36519 - 36462
Alignment:
| Q |
223 |
cgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgt |
281 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
36519 |
cgaaattgttaggctg-atgacatgatcgggattcgaaccccggtacctccacttgtgt |
36462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 248 - 290
Target Start/End: Original strand, 27928 - 27970
Alignment:
| Q |
248 |
atcggggttcgaaccccggtacctctacttgtgtgtgtgagtt |
290 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27928 |
atcggggttcgaaccccggtacctccacttgtgtgtgtgagtt |
27970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0364 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0364
Description:
Target: scaffold0364; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 11997 - 12077
Alignment:
| Q |
211 |
ttggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||| |||||||||||||| |||| | ||||| ||||| || ||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
11997 |
ttggtaaaatgtcgaaattattagaccggatgccatgaccgatgttcgaacctcggtaccttcacttgtgtgtgtgagttt |
12077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 22107 - 22182
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||||| |||||| ||| | ||| |||||||||||||||||||||||| |||||| || |||||||||||||||| |
|
|
| T |
22107 |
aaaatgtcaaaattgatagcc-ggacgtcatgatcggggttcgaaccccgatacctccactttgtgtgtgtgagttt |
22182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 272
Target Start/End: Complemental strand, 19417 - 19361
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctc |
272 |
Q |
| |
|
||||||| ||||||||||||| ||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
19417 |
aaaatgttgaaattgttaggccggacgtcatgattggggttcgaaccccgatacctc |
19361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 212 - 277
Target Start/End: Original strand, 18075 - 18140
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctactt |
277 |
Q |
| |
|
||||||||| ||||||||||| || ||||| ||||||||||||| |||||||| |||||| |||| |
|
|
| T |
18075 |
tggcaaaataccgaaattgttaagccggatgccatgatcggggtttgaaccccgatacctccactt |
18140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 291
Target Start/End: Original strand, 22944 - 23020
Alignment:
| Q |
216 |
aaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctac-ttgtgtgtgtgagttt |
291 |
Q |
| |
|
|||||| |||||||||||||| ||| ||||||| | || ||||||||||||||||| || |||||||| ||||||| |
|
|
| T |
22944 |
aaaatgccgaaattgttaggccggacgtcatgactgaggatcgaaccccggtacctccactttgtgtgtttgagttt |
23020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 296
Target Start/End: Original strand, 95169 - 95253
Alignment:
| Q |
212 |
tggcaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagttttataa |
296 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||| |||||||| ||||| | ||||| | || |||||||| ||||||||| |
|
|
| T |
95169 |
tggcaaaatgccgaaattgttaggccggatgccatggtcggggtttgaacctcaataccttcatttatgtgtgtgggttttataa |
95253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University