View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2334_low_7 (Length: 283)
Name: NF2334_low_7
Description: NF2334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2334_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 56097457 - 56097732
Alignment:
| Q |
1 |
catcgatcaatccagccacctttgttttgttgtgcaagtaaaggaaggtaacggaaaccttgaaaaagaagatgatggcctaaatgggttgtgaattgtg |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
56097457 |
catcgatcactccagccacctttgttttgttgtgcaagtaaaggaaggtaacggaaaccatgaaaaagaagatgatggcgtaaatgggttgtgaattgtg |
56097556 |
T |
|
| Q |
101 |
attgtatattttggaatgaaacaagtgtcgtgcatgcatgcataagatcattgactttagagttacaagtgtctttcatgcattcttcaataatatgatc |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56097557 |
attgtatattttggaatggaacaagtgtcgtgcatgcatgcataagatcattgactttagagttacaagtgtctttcatgcattcttcaataatatgatc |
56097656 |
T |
|
| Q |
201 |
ataatacataatacaaggatctgtc----tgtctgtctccactattaccaccttttacgcctttttatctgtctgt |
272 |
Q |
| |
|
||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56097657 |
ataatgcataatacaaggatctgtctgtttgtatgtctccactattaccaccttttacgcctttttatctgtctgt |
56097732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University