View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2335_high_19 (Length: 253)
Name: NF2335_high_19
Description: NF2335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2335_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 35445817 - 35446067
Alignment:
| Q |
1 |
tgacactatcaaatatcacatggatttgttaaaaaggttataaatgctactttctttatctaaagaaaacatatatttcaatgaatatgtaggtggatag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35445817 |
tgacactatcaaatatcacatggatttgttaaaaaggttataaatgctactttctttatctaaagaaaacatatatttcaatgaatatgtaggtggagag |
35445916 |
T |
 |
| Q |
101 |
ggcaatgaagaagaagaagcagatagtgtttgcaggacactcgtctggtggtccagtggctattctggcagcactttgggccttagtaaacttcccaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35445917 |
ggcaatgaagaagaagaagcagatagtgtttgcaggacactcgtctggtggtccagtggctattctggcagcactttgggccttagtaaacttcccaact |
35446016 |
T |
 |
| Q |
201 |
acaaaattccccgatcgtatccctcccatctgtattacctttgcttctcct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
35446017 |
acaaaattccccgatcgtatccctcccatctgtattacttttggttctcct |
35446067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University