View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2335_high_21 (Length: 251)
Name: NF2335_high_21
Description: NF2335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2335_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 14166763 - 14167006
Alignment:
| Q |
1 |
atacaatgccttctgaaattcatcagatccttcatccaacagcttctgtaaagattaaacggacacaaatttaaataacgagttataatatcataannnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
14166763 |
atacaatgccttctgaaattcatcagatccttcatccaacagcttctgtaaagattaaacggacacaaatttaaataacgaatcataatatcataatttt |
14166862 |
T |
|
| Q |
101 |
nnnaatatcgtaatctttttattatataccttagtgatggaagtaccatgagtctctctgtagcggttgaatgtcgcaatcagctgggttttgctccttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14166863 |
tttaatatcgtaatctttttattatataccttagtgatggaagtaccatgagtctctctgtagcggttgaatgtcgcaatcagctgggttttgctccttg |
14166962 |
T |
|
| Q |
201 |
tagtcaagatcctaatggcttcttcatgacttcctttcttctct |
244 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14166963 |
tagtcaagatccttatggcttcttcatggcttcctttcttctct |
14167006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 155 - 244
Target Start/End: Original strand, 14173880 - 14173969
Alignment:
| Q |
155 |
tctctgtagcggttgaatgtcgcaatcagctgggttttgctccttgtagtcaagatcctaatggcttcttcatgacttcctttcttctct |
244 |
Q |
| |
|
||||||||||||||||| || || | ||||| || |||||||||||||| | ||| |||||||||||||||||| ||||||| |||||| |
|
|
| T |
14173880 |
tctctgtagcggttgaaagttgccaaaagctgagtcttgctccttgtagtaaggattctaatggcttcttcatgatttccttttttctct |
14173969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University