View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2335_low_27 (Length: 251)

Name: NF2335_low_27
Description: NF2335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2335_low_27
NF2335_low_27
[»] chr8 (1 HSPs)
chr8 (110-248)||(10414613-10414751)


Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 110 - 248
Target Start/End: Original strand, 10414613 - 10414751
Alignment:
110 aaatccaacttcaaaacatatggttataccaaacaaaagaggactagacatatggcttggtttggtagattgtcgatttctgatcttacatttcaactta 209  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10414613 aaatccaacttcaaaacatatggttataccaaacaaaagaggacaagacatatggcttggtttggtagattgtcgatttctgatcttacatttcaactta 10414712  T
210 atcgttctcttgttaataagatgagagaataatttaccc 248  Q
    ||| ||||||||||||||||||||||||| |||||||||    
10414713 atcattctcttgttaataagatgagagaagaatttaccc 10414751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University