View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2335_low_27 (Length: 251)
Name: NF2335_low_27
Description: NF2335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2335_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 110 - 248
Target Start/End: Original strand, 10414613 - 10414751
Alignment:
| Q |
110 |
aaatccaacttcaaaacatatggttataccaaacaaaagaggactagacatatggcttggtttggtagattgtcgatttctgatcttacatttcaactta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10414613 |
aaatccaacttcaaaacatatggttataccaaacaaaagaggacaagacatatggcttggtttggtagattgtcgatttctgatcttacatttcaactta |
10414712 |
T |
 |
| Q |
210 |
atcgttctcttgttaataagatgagagaataatttaccc |
248 |
Q |
| |
|
||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10414713 |
atcattctcttgttaataagatgagagaagaatttaccc |
10414751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University