View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2335_low_34 (Length: 240)
Name: NF2335_low_34
Description: NF2335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2335_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 30727209 - 30726993
Alignment:
| Q |
1 |
cccttagggcctgtttagcaagcaaataaaaacaacagaaaaggttcagtttagtagtactaaaagcaagcaaaatacagaagctaccttataacaatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30727209 |
cccttagggcctgtttagcaagcaaataaaaacaacagaaaaggttcagtttagta---ctaaaagcaagcaaaatacagaagctaccttataacaatac |
30727113 |
T |
 |
| Q |
101 |
ttttccagctaccnnnnnnnnnctctcttctctcatattttcttttaagttgctttcaaatagaactacaaggacatgcaaatacaaatgcaaccctagt |
200 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30727112 |
ttttccagctaccttttttt---tctctcctctcatattttcttttaagttgctttcaaatagaactacaaggacatgcaaatacaaatgcaaccctagt |
30727016 |
T |
 |
| Q |
201 |
taaaaaatagacaccactatgtt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30727015 |
taaaaaatagacaccactatgtt |
30726993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University