View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2335_low_36 (Length: 238)
Name: NF2335_low_36
Description: NF2335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2335_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 34279533 - 34279321
Alignment:
| Q |
18 |
agatactcattaattatgattcttgtcatatttgttgtaaaatatggcaatatgtgcccatgttattattcgattgagtttgctatatttgttattgtaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34279533 |
agatactcattaattatgattcttgtcatatttgttgtaaaatatgacattatgtgcccatgttattattcgattgagtttgctatatttgttattgtaa |
34279434 |
T |
 |
| Q |
118 |
actatgtaccttgacgnnnnnnnnnnnnnnaagaaactatgtaccttgacgttgtaaactagagaaggataaacaatattttcagggcattggttaagta |
217 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34279433 |
actatgtaccttgacgtttttttttttttgaagcaactatgtaccttgacgttgtaaactagagaaggataaacaatattttcagggcattggttaagta |
34279334 |
T |
 |
| Q |
218 |
aataaaacaagta |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34279333 |
aataaaacaagta |
34279321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University