View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2335_low_36 (Length: 238)

Name: NF2335_low_36
Description: NF2335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2335_low_36
NF2335_low_36
[»] chr5 (1 HSPs)
chr5 (18-230)||(34279321-34279533)


Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 34279533 - 34279321
Alignment:
18 agatactcattaattatgattcttgtcatatttgttgtaaaatatggcaatatgtgcccatgttattattcgattgagtttgctatatttgttattgtaa 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||    
34279533 agatactcattaattatgattcttgtcatatttgttgtaaaatatgacattatgtgcccatgttattattcgattgagtttgctatatttgttattgtaa 34279434  T
118 actatgtaccttgacgnnnnnnnnnnnnnnaagaaactatgtaccttgacgttgtaaactagagaaggataaacaatattttcagggcattggttaagta 217  Q
    ||||||||||||||||              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34279433 actatgtaccttgacgtttttttttttttgaagcaactatgtaccttgacgttgtaaactagagaaggataaacaatattttcagggcattggttaagta 34279334  T
218 aataaaacaagta 230  Q
    |||||||||||||    
34279333 aataaaacaagta 34279321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University