View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2335_low_37 (Length: 234)
Name: NF2335_low_37
Description: NF2335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2335_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 72 - 218
Target Start/End: Complemental strand, 21835168 - 21835022
Alignment:
| Q |
72 |
aattaagtcaaatttgctcgtataatgagtagtctgacatttttgacagatttatgacaagtgagaaagtattaagacaccgatgagatcaaacttcagc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21835168 |
aattaagtcaaatttgctcgtataatgagtagtctgacatttttgacagatttacgacaagtgagaaagtgttaagacaccgatgagatcaaacttcagc |
21835069 |
T |
|
| Q |
172 |
aagcaaagtaaatcaaactcaagctaataattccaacaacaacaaac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21835068 |
aagcaaagtaaatcaaactcaagctaataattccaacaacaacaaac |
21835022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 12 - 77
Target Start/End: Complemental strand, 21835325 - 21835260
Alignment:
| Q |
12 |
gatatgaagaaaagttttaagaccctaataacaaggattgccatatacacaccttttatgaattaa |
77 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21835325 |
gatataaagaaaagttttaagaccctaataacaaggattgccatatacacaacttttatgaattaa |
21835260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 188
Target Start/End: Complemental strand, 47911742 - 47911680
Alignment:
| Q |
126 |
tgacaagtgagaaagtattaagacaccgatgagatcaaacttcagcaagcaaagtaaatcaaa |
188 |
Q |
| |
|
|||||||||||| | ||||| ||||||||||||||||| || |||||| ||| ||||||||| |
|
|
| T |
47911742 |
tgacaagtgagataatattactacaccgatgagatcaaaattaagcaagaaaaataaatcaaa |
47911680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University