View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_high_21 (Length: 382)
Name: NF2336_high_21
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 348
Target Start/End: Original strand, 25771855 - 25772200
Alignment:
| Q |
1 |
ctcatattttggaaatgaatctttttactattttattgagacaattgaagcttgaggatgttagtccgattgggaggaggttcacatggtatcattcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25771855 |
ctcatattttggaaatgaatctttttactattttattgagacaattggagcttgaggatgttagtccgattgggaggaggttcacatggtatcattcaaa |
25771954 |
T |
|
| Q |
101 |
tgatcgtgaaatcagttggattgatagaattcttgtttcgcggaagaatgaactaattattaggggaattaagtgttgtgggtgcctccgcgagatatat |
200 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25771955 |
tgatcatgaaatgagttggattgatagaattcttgtttcg--gaagaatgaattaattattaggggaattaagtgttgtgggtgcctccgcgagatatat |
25772052 |
T |
|
| Q |
201 |
cggatcattgcactttggtgttaaaggtgaataattgttaaagagggagacatggggaatcccaccactgtgaggcaaaaggaggtaggctttgtccata |
300 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
25772053 |
cggatcattgttctttggtgttaaaggtgaataattgttaaagagggagacatggggaatcccaccactttgaggcaaaaggaggtacgctttgtccata |
25772152 |
T |
|
| Q |
301 |
gccagagcattggcaacttggttgccctccctatagtgaacttaaggt |
348 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25772153 |
gcctgagcattggcaacttggttgccctccctatagtgaacttaaggt |
25772200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University