View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_high_35 (Length: 272)
Name: NF2336_high_35
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 53661376 - 53661160
Alignment:
| Q |
18 |
atgtacgaccttcttcataaacagaaaactgtccttgctcttccatctttgctaaaagtagccattgatgtttctgaagggatgaaatatttgcatcaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53661376 |
atgtacgaccttcttcataaacagaaaactgtccttgctcttccatctttgctaaaagtagccattgatgtttctgaagggatgaaatatttgcatcaga |
53661277 |
T |
 |
| Q |
118 |
atgatatcatacaccgggacctcaagtcagctaatcttttgatagataagactggagtaagctcacattgattacttttaaattttactggcttattgta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53661276 |
atgatatcatacaccgggacctcaagtcagctaatcttttgatagataagactggagtaagctcacattgattacttttaaattttactggcttattgta |
53661177 |
T |
 |
| Q |
218 |
ttttagttgatgctgtc |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
53661176 |
ttttagttgatgctgtc |
53661160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 57 - 160
Target Start/End: Original strand, 9207854 - 9207957
Alignment:
| Q |
57 |
cttccatctttgctaaaagtagccattgatgtttctgaagggatgaaatatttgcatcagaatgatatcatacaccgggacctcaagtcagctaatcttt |
156 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| | || ||||| |||||||| || ||| |||| || ||| ||||||||||| | || |||||| |
|
|
| T |
9207854 |
cttccatctttactaaaagtagccattgatgtttccaagggaatgaactatttgcaccaaaataatattattcacagggacctcaagactgccaatcttc |
9207953 |
T |
 |
| Q |
157 |
tgat |
160 |
Q |
| |
|
|||| |
|
|
| T |
9207954 |
tgat |
9207957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University