View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_high_50 (Length: 247)
Name: NF2336_high_50
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_high_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 4 - 240
Target Start/End: Original strand, 1135888 - 1136124
Alignment:
| Q |
4 |
ggttagcaaaaatatataactaaagattcatatttatgttggacatgtctcaaataggataacatttgatggagggaacctaggagaaccctaaataaat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
1135888 |
ggttagcaaaaatatataactaaagattcatatttatgttggacatgtctcaaataggataacattcgatggagggaacctatgagaaccctaaataaat |
1135987 |
T |
 |
| Q |
104 |
aaaatttgaataagaagtttaggcgagctccgctccaagtgctcattagggttagtgcatatgtcaagctcaaagagtttttgcggggatcacccattaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1135988 |
aaaatttgaataagaagtttaggcgagctccgctccaagtgctcattagggttagtgcatatgtcaagctcaaagagtttttacggggatcacccattaa |
1136087 |
T |
 |
| Q |
204 |
aaatgtcctcacttcaacaacgataatttaacctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1136088 |
aaatgtcctcacttcaacaacgataatttaacctatg |
1136124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University