View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_high_59 (Length: 241)
Name: NF2336_high_59
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_high_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 223
Target Start/End: Complemental strand, 44391027 - 44390815
Alignment:
| Q |
11 |
cacagatacaaataacaatactcgttttattcaaatgtttggagaaagttgcatcgacattacatttaaagaaaactctttgtgggcgttgtcacctaac |
110 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44391027 |
cacagatacaaataacaatgctcgttttattcaaatgtttggagaaagttgtatcgacattacatttaaagaaaactctttgccggcgttgtcacctaac |
44390928 |
T |
|
| Q |
111 |
tagagttgtaacaaccatcgttgaagtatagggattacgaatcatacctaatgcaccttgcctttatgttgttgtagctatcgtttgatcatcgcaggaa |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44390927 |
tagagttgtaacaaccatcattgaagtatagggattacgaagcatacctaatgcaccttgcctttatgttgttgtagctatcgtttgatcatcgcaggaa |
44390828 |
T |
|
| Q |
211 |
gtttgttgagttg |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44390827 |
gtttgttgagttg |
44390815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University