View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_high_60 (Length: 241)
Name: NF2336_high_60
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_high_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 23 - 230
Target Start/End: Complemental strand, 43366669 - 43366462
Alignment:
| Q |
23 |
gggtacttcaaccacattgttgaaccatggatcaatcgactccctgcaaaacagccattnnnnnnngaatcactgcaatttatgaaagtannnnnnnnca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
43366669 |
gggtacttcaaccacattgttgaaccatggatcaatcgactccctgcaaaacagccattaaaaaaataatcactgcaatttatgaaagtattttttttca |
43366570 |
T |
 |
| Q |
123 |
cagctagcactttctaatcgtcctgctcaggaaatttttgtggctctacatatcttgtaatattctcacaatatctttgaatcaattgtcagtgtatgtt |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366569 |
cagcttgcactttctaatcgtcctgctcaggaaatttttgtggctctacatatcttgtaatattctcacaatatctttgaatcaattgtcagtgtatgtt |
43366470 |
T |
 |
| Q |
223 |
gtttttga |
230 |
Q |
| |
|
|||||||| |
|
|
| T |
43366469 |
gtttttga |
43366462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University