View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_high_62 (Length: 239)
Name: NF2336_high_62
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_high_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 29087115 - 29086894
Alignment:
| Q |
1 |
tttcttattcttattcttttgttaaaaagtaattttatgacaatccatgtctatcattctcaatttttaaaaaataaacaagacaatccatatctctttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29087115 |
tttcttattcttattcttttgttaaaaagtaattttatgacaatccatgtctatcatgctcaatttttaaataataaacaagacaatccatatctctttt |
29087016 |
T |
|
| Q |
101 |
aatatggaccatgaaaatagagtgtatagtttgtaattatgcataattcattactgggtcaacatgacctttttcaagcaaaaataaataatatatcaca |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
29087015 |
aatatggaccataaaaatagagtgtatagtttgtaattatgcataattcattattgggtcaacatgacctttttcaagccaaaataaataatatatcgca |
29086916 |
T |
|
| Q |
201 |
ctgtattagtcaatgccatgat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29086915 |
ctgtattagtcaatgccatgat |
29086894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University