View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_high_70 (Length: 222)
Name: NF2336_high_70
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_high_70 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 15152728 - 15152543
Alignment:
| Q |
13 |
aagaatattgtatattgatgggcctgatgggtttagaacttgatgagtggataatgaatttaatgaagnnnnnnnt--tcaatgagtgctataagcatga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
15152728 |
aagaatattgtatattgatgggcctgatgggtttagaacttgatgagtggataatgaatttaatgaagaaaaaaaaaatcaatgagtgctgtaagcatga |
15152629 |
T |
|
| Q |
111 |
aggagaatattttgtaaaaaatgtgctcccccattgtcatatgttcaaatttttagttacattttggccataccaccatgtgatat |
196 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15152628 |
aggagaatattttgaaaaaaatgtgctcccccattgtcatatgttcaaatttttagttacattttggccataccaccatgtgatat |
15152543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University