View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_high_72 (Length: 203)
Name: NF2336_high_72
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_high_72 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 26743778 - 26743586
Alignment:
| Q |
1 |
ctataaagaatacaatgccctttggtacttcatcatgaatcctagcatatttttatatcatatcacatcaattaatacatacaacttcaactcgaactaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26743778 |
ctataaagaatacaatgccctttggtacttcgtcatgaatcctagcatatttttatatcatatcacatcaattaatacatacaacttcaactcgaactaa |
26743679 |
T |
 |
| Q |
101 |
tcaagtagaattttcaacatcatgttacctnnnnnnnncgtttcaacatcatgtgattaatttttattgaaaaatttgtgactgtgatctgtg |
193 |
Q |
| |
|
||||| |||| ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
26743678 |
tcaagcagaagtttcaacatcatgttacctaaaaaaaacgtttcaacatcatgtgattaattttcattgaaaaatttgtgactgtgatttgtg |
26743586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University