View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2336_high_73 (Length: 201)

Name: NF2336_high_73
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2336_high_73
NF2336_high_73
[»] chr1 (2 HSPs)
chr1 (15-180)||(3744073-3744238)
chr1 (45-104)||(3744217-3744278)
[»] chr3 (1 HSPs)
chr3 (37-80)||(20196243-20196286)


Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 180
Target Start/End: Original strand, 3744073 - 3744238
Alignment:
15 cagagaagatttttggaatatggaacagagaagctttgcacaagagaaagcatatggcatagatagaaacagtgacacatcattcgggataaaacgctat 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
3744073 cagagaagatttttggaatatggaacagagaagctttgcacaagagaaagcatatggcatagattgaaacagtgacacatcattcgggataaaacgctat 3744172  T
115 gtttagcattattgaaacatagcaaaaacgttttatcccgtagcatcccaaatgatgtatcactgt 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3744173 gtttagcattattgaaacatagcaaaaacgttttatcccgtagcatcccaaatgatgtatcactgt 3744238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 104
Target Start/End: Complemental strand, 3744278 - 3744217
Alignment:
45 aagctttgcacaagagaaagcatatggcatag--atagaaacagtgacacatcattcgggat 104  Q
    ||||||| |||||||||||||| |||||||||  |||| |||||||| |||||||| |||||    
3744278 aagctttacacaagagaaagcacatggcatagatataggaacagtgatacatcatttgggat 3744217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 37 - 80
Target Start/End: Original strand, 20196243 - 20196286
Alignment:
37 gaacagagaagctttgcacaagagaaagcatatggcatagatag 80  Q
    ||||| ||||| ||||||||||||||||||| ||||||||||||    
20196243 gaacaaagaagttttgcacaagagaaagcatgtggcatagatag 20196286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University