View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_low_18 (Length: 405)
Name: NF2336_low_18
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 38 - 390
Target Start/End: Original strand, 15501280 - 15501632
Alignment:
| Q |
38 |
agttcaacataacaaaaatggcttcacaaatcaaattctcattgttcacaatttttatctttgttttggccatggtggttgccggtcacgacgggcatgt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15501280 |
agttcaacataacaaaaatggcttcacaaatcaaattctcattgttcacaatttttatctttgttttggccatggtggttgccggtcacgacgggcatgt |
15501379 |
T |
 |
| Q |
138 |
tcactctccggcggaagcaccttctagctttgcaagcagcctcaattgtcactcagtaattggtggatttgttcctattctgattgcaattctctttgcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15501380 |
tcactctccggcggaagcaccttctagctttgcaagcagcctcaattgtcactcagtaattggtggatttgttcctattctcattgcaattctctttgcc |
15501479 |
T |
 |
| Q |
238 |
agaaatggtctttgagaannnnnnnncatggattttcatttccttcttggttattttcatgtcatttacgttttgaccttcctatgttgtttgattgaat |
337 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15501480 |
agaaatggtctttgagaattttttttcatggattttcatttccttcttggttattttcatgtcatttacgttttgaccttcctatgttgtttgattgaat |
15501579 |
T |
 |
| Q |
338 |
tgttgtatcaataagctgtgtgcacttgatgtttttcatcacatgtatggatc |
390 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15501580 |
tgttgtattaataagctgtgtgcacttgatgtttttcatcacatgtatggatc |
15501632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University