View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2336_low_27 (Length: 327)

Name: NF2336_low_27
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2336_low_27
NF2336_low_27
[»] chr2 (1 HSPs)
chr2 (7-224)||(15446899-15447112)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 7 - 224
Target Start/End: Complemental strand, 15447112 - 15446899
Alignment:
7 gagatgaagtcaaagatcataaataaataaataaattgtgcacaagcattatattccaggaacatctatgtatgttgcatgaaggagagttatgttgaaa 106  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15447112 gagaagaagtcaaagatcataaataaataaataaattgtgcacaagcattatattccaggaacatctatgtatgttgcatgaaggagagttatgttgaaa 15447013  T
107 atgcaattgttccgatttaaatttgatggcattaattgaattttcaaccttatatattttcatttttaaagactgttttgaaaagaagcgaaatacatca 206  Q
    ||||||||||||||||||||||||| ||||    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||    
15447012 atgcaattgttccgatttaaatttgttggc----attgaattttcaaccttatatattttcatttttaaagactattttgaaaagaagcgaagtacatca 15446917  T
207 tccgatcattattataag 224  Q
    | || ||| |||||||||    
15446916 ttcggtcactattataag 15446899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University