View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_low_28 (Length: 318)
Name: NF2336_low_28
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 210 - 282
Target Start/End: Complemental strand, 42559581 - 42559509
Alignment:
| Q |
210 |
attcatatgaaaattatataccaccatcgtataatctaaaataaattattttagacttattttggtccgattt |
282 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42559581 |
attcagatgaaaattatataccaccatcgtataatctaaaataaattattttagacttattttggtcagattt |
42559509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 42559812 - 42559760
Alignment:
| Q |
43 |
tttgttcaaaacaattagatatatcatcgaaatcatgagaaccaaacatatat |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42559812 |
tttgttcaaaacaattagatatatcatcgaaatcatgagaacggaacatatat |
42559760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 93 - 127
Target Start/End: Complemental strand, 42559701 - 42559667
Alignment:
| Q |
93 |
tattaagcactagatattattttagtgaactatac |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
42559701 |
tattaagcactagatattcttttagtgaactatac |
42559667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University