View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_low_32 (Length: 301)
Name: NF2336_low_32
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 13 - 285
Target Start/End: Original strand, 55163359 - 55163629
Alignment:
| Q |
13 |
cacagacaatgatttcaacaacttaccatcaggtgatgtggtggataaacttcttcaagagtggcaaactagttctgtacaaggtatcacagatgagcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55163359 |
cacagacaatgatttcaacaacttaccatcaggtgatgtggtggataaacttcttcaagagtggcaaactagttctgtacaaggtatcacagatgagcat |
55163458 |
T |
 |
| Q |
113 |
ggttcaaatagcttttatggattcttaggagaatatagaattagggtcgagtatcgcaacaagactatagattcaactttctctctatgtagaggtgaag |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55163459 |
ggttcacatagcttttatggattcttaggagaatatagaattagggtcgagtatcgcaacaagactataaattcaactttctctctatgtagaggtgaag |
55163558 |
T |
 |
| Q |
213 |
aaactaaacatgtccctgtgacactgtgacttaatttttatttatgaacctccttaacttttcactagaacct |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55163559 |
aaactaaacatgtccctgtgacactgtgacttaatttttatttatgaacctccttaac--ttcactagaacct |
55163629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University