View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_low_40 (Length: 260)
Name: NF2336_low_40
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 9 - 245
Target Start/End: Complemental strand, 6601717 - 6601485
Alignment:
| Q |
9 |
gagatgaaacaaccgcaagtgagagcgacgcaaataacttgccatcaccctttgaacctctagaaaacattactgccaagttcatttctaagggtcttga |
108 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6601717 |
gagatggaacaaccgcgagtgagagcgacgcaaataacttgccatcaccctttgaacctctagaaaacattactgccaagttcatttctaagggtcttga |
6601618 |
T |
 |
| Q |
109 |
aaagaaagatgtagcagtgctctcaggtttgcttcccttgcaattatttgtaccaaaatatttatatataacatgtataacgtttatgattcgtgttcga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6601617 |
aaagaaagatgtagcagtgctctcaggtttgcttcccttgcaattatttgtaccaaaatatt----tataacatgtataacgtttatgattcgtgttcga |
6601522 |
T |
 |
| Q |
209 |
attatgttatcgtcattttcaaggctaacatatttct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6601521 |
attatgttatcgtcattttcaaggctaacatatttct |
6601485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 6609244 - 6609101
Alignment:
| Q |
17 |
acaaccgcaagtgagagcgacgcaaataacttgccatcaccctttgaacctctagaaaacattactgccaagttcatttctaagggtcttgaaaagaaag |
116 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||| || |||||||||||||| | |
|
|
| T |
6609244 |
acaaccgcgagtgagagtgaggcaaataacttgccatcaccctttgaacctcttgaaaatattactgctaagttcatttccaaaggtcttgaaaagaagg |
6609145 |
T |
 |
| Q |
117 |
atgtagcagtgctctcaggtttgcttcccttgcaattatttgta |
160 |
Q |
| |
|
|||||||||||||||||||||| ||||| | |||||||||||| |
|
|
| T |
6609144 |
atgtagcagtgctctcaggtttacttccttcacaattatttgta |
6609101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 54 - 111
Target Start/End: Original strand, 44799831 - 44799889
Alignment:
| Q |
54 |
caccctttgaacctctagaaaacattact-gccaagttcatttctaagggtcttgaaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| || ||||||||||| |
|
|
| T |
44799831 |
caccctttgaacctctagaaaacattactggccaagtacatttccaaaggtcttgaaaa |
44799889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University