View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_low_46 (Length: 250)
Name: NF2336_low_46
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 249
Target Start/End: Original strand, 40282652 - 40282896
Alignment:
| Q |
7 |
tcgaagaatatttaattaatttgaagatatgaagatgaattcaacttagatttccaatgagcatatacctaaacatatgttcagttaagaagttactagt |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40282652 |
tcgaacaatatttaattaatttgaagatatgaagatgaattcaacttagatttccaatgagcatatacctaaacatatgttcagttaagaagttactagt |
40282751 |
T |
 |
| Q |
107 |
ttatcaactaatcaaatgacaagtagtaacaaatcattag--tatataatcatcatctccctgcaataaaggtaggtgacaccgaccaggcaaccacttt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40282752 |
ttatcaactaatcaaatgacaagtagtaacaaatcattagtatatataatcatcatctccctgcaataaaggtaggtgacaccgaccaagcaaccacttt |
40282851 |
T |
 |
| Q |
205 |
gctaccttaacgttaaattgtttatgcaaacaaattgaaaaacat |
249 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
40282852 |
gctaccttaacgttgaattgtttatataaacaaattgaaagacat |
40282896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University