View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2336_low_51 (Length: 248)

Name: NF2336_low_51
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2336_low_51
NF2336_low_51
[»] chr1 (1 HSPs)
chr1 (114-142)||(43366798-43366826)


Alignment Details
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 142
Target Start/End: Complemental strand, 43366826 - 43366798
Alignment:
114 actcattgcatcactaatcaaatactagt 142  Q
    |||||||||||||||||||||||||||||    
43366826 actcattgcatcactaatcaaatactagt 43366798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University