View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2336_low_54 (Length: 247)

Name: NF2336_low_54
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2336_low_54
NF2336_low_54
[»] chr1 (1 HSPs)
chr1 (4-240)||(1135888-1136124)


Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 4 - 240
Target Start/End: Original strand, 1135888 - 1136124
Alignment:
4 ggttagcaaaaatatataactaaagattcatatttatgttggacatgtctcaaataggataacatttgatggagggaacctaggagaaccctaaataaat 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||    
1135888 ggttagcaaaaatatataactaaagattcatatttatgttggacatgtctcaaataggataacattcgatggagggaacctatgagaaccctaaataaat 1135987  T
104 aaaatttgaataagaagtttaggcgagctccgctccaagtgctcattagggttagtgcatatgtcaagctcaaagagtttttgcggggatcacccattaa 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
1135988 aaaatttgaataagaagtttaggcgagctccgctccaagtgctcattagggttagtgcatatgtcaagctcaaagagtttttacggggatcacccattaa 1136087  T
204 aaatgtcctcacttcaacaacgataatttaacctatg 240  Q
    |||||||||||||||||||||||||||||||||||||    
1136088 aaatgtcctcacttcaacaacgataatttaacctatg 1136124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University