View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2336_low_64 (Length: 241)

Name: NF2336_low_64
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2336_low_64
NF2336_low_64
[»] chr1 (1 HSPs)
chr1 (23-230)||(43366462-43366669)


Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 23 - 230
Target Start/End: Complemental strand, 43366669 - 43366462
Alignment:
23 gggtacttcaaccacattgttgaaccatggatcaatcgactccctgcaaaacagccattnnnnnnngaatcactgcaatttatgaaagtannnnnnnnca 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||        ||    
43366669 gggtacttcaaccacattgttgaaccatggatcaatcgactccctgcaaaacagccattaaaaaaataatcactgcaatttatgaaagtattttttttca 43366570  T
123 cagctagcactttctaatcgtcctgctcaggaaatttttgtggctctacatatcttgtaatattctcacaatatctttgaatcaattgtcagtgtatgtt 222  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43366569 cagcttgcactttctaatcgtcctgctcaggaaatttttgtggctctacatatcttgtaatattctcacaatatctttgaatcaattgtcagtgtatgtt 43366470  T
223 gtttttga 230  Q
    ||||||||    
43366469 gtttttga 43366462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University