View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_low_68 (Length: 239)
Name: NF2336_low_68
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_low_68 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 48421897 - 48422119
Alignment:
| Q |
17 |
caagcattgggttgtaagccaaatctttagccatttttgtagaaggatctcaaggcatcctcttcttcactgtttatggcaacaccaatacctattgcat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
48421897 |
caagcattgggttgtaagccaaatctttagccatttttgtagaaggatctcaaggcatcctcttcttcagtgtttattgcaacaccaatacctattgcat |
48421996 |
T |
|
| Q |
117 |
tgaacaaggcaacatctttggagtctgcatcctcgacaacttccactgcgcaatttaaactgtcaaatccttgtcaatttaagatgtggtgtgaatttga |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48421997 |
tgaacaaggcagcatctttggagtctgcatcctcgacaacttccactgcgcaatttaaactgtcaaatccttgtcaatttaagatgtggtgtgaatttga |
48422096 |
T |
|
| Q |
217 |
tttaggagcaacttcaccaactc |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
48422097 |
tttaggagcaacttcaccaactc |
48422119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University