View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2336_low_75 (Length: 225)
Name: NF2336_low_75
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2336_low_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 39918434 - 39918352
Alignment:
| Q |
19 |
ctattcccattcttctatgatttggagaaactcttaagcctaaaacgtaggctagttttgtgaaaacagggacatgattggaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918434 |
ctattcccattcttctatgatttggagaaactcttaagcctaaaacgtaggctagttttgtgaaaacagggacatgattggaa |
39918352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 150 - 212
Target Start/End: Complemental strand, 39918303 - 39918241
Alignment:
| Q |
150 |
ccgcatgtaacggttttgatacaacctcgtatcattccgactgtctcattgcctatctctgct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918303 |
ccgcatgtaacggttttgatacaacctcgtatcattccgactgtctcattgcctatctctgct |
39918241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University