View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2336_low_77 (Length: 212)

Name: NF2336_low_77
Description: NF2336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2336_low_77
NF2336_low_77
[»] chr8 (1 HSPs)
chr8 (12-193)||(9802934-9803120)


Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 12 - 193
Target Start/End: Complemental strand, 9803120 - 9802934
Alignment:
12 agaagcaaaggacgatgattgaagagacaacaatggtaaaacaaacatcataagtaaacaaagagtttaaacatatgaaacatgtttcaaacctttggga 111  Q
    |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9803120 agaaacaaaggacaatgattgaagagacaacaatggtaaaacaaacatcataagtaaacaaagagtttaaacatatgaaacatgtttcaaacctttggga 9803021  T
112 aaaactagga-----nnnnnnnnnnnnnngcaatgaaatgaaggtgtggagaatgaaaagagagaagaacggcgtttgcgcttttct 193  Q
    ||||||||||                   |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
9803020 aaaactaggatttttttttttttttttttgcaatgaaatgaaggtgtggagaatgaaaagaaagaagaacggcgtttgcgcttttct 9802934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University