View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2337-Insertion-11 (Length: 162)
Name: NF2337-Insertion-11
Description: NF2337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2337-Insertion-11 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 2e-78; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 8 - 162
Target Start/End: Original strand, 175695 - 175850
Alignment:
| Q |
8 |
aactcaacaaccatcgtccctgatatgaagctcaactttcctctaaatccttctaacattcgtgctatcatagctgactcttgcgatggcatcatctgtc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
175695 |
aactcaacaaccatcgtccctgatatgaagctcaactttcctctaaatccttctaacattcgtgctatcatagctgactcttgcgatggcatcatctgtc |
175794 |
T |
 |
| Q |
108 |
ttc-aaccatcgatgacagattcgactgtggtgatccgctactatggaacccttgt |
162 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
175795 |
ttcaaaccatcgatgacagattcgactgtggtgatccgctactatggaacccttgt |
175850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 28; Significance: 0.0000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 34 - 73
Target Start/End: Original strand, 55419207 - 55419246
Alignment:
| Q |
34 |
gaagctcaactttcctctaaatccttctaacattcgtgct |
73 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||||||||| |
|
|
| T |
55419207 |
gaagctcaactttcctcgaaatgcttctgacattcgtgct |
55419246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University