View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2337-Insertion-11 (Length: 162)

Name: NF2337-Insertion-11
Description: NF2337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2337-Insertion-11
NF2337-Insertion-11
[»] chr6 (1 HSPs)
chr6 (8-162)||(175695-175850)
[»] chr4 (1 HSPs)
chr4 (34-73)||(55419207-55419246)


Alignment Details
Target: chr6 (Bit Score: 148; Significance: 2e-78; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 8 - 162
Target Start/End: Original strand, 175695 - 175850
Alignment:
8 aactcaacaaccatcgtccctgatatgaagctcaactttcctctaaatccttctaacattcgtgctatcatagctgactcttgcgatggcatcatctgtc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
175695 aactcaacaaccatcgtccctgatatgaagctcaactttcctctaaatccttctaacattcgtgctatcatagctgactcttgcgatggcatcatctgtc 175794  T
108 ttc-aaccatcgatgacagattcgactgtggtgatccgctactatggaacccttgt 162  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
175795 ttcaaaccatcgatgacagattcgactgtggtgatccgctactatggaacccttgt 175850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 28; Significance: 0.0000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 34 - 73
Target Start/End: Original strand, 55419207 - 55419246
Alignment:
34 gaagctcaactttcctctaaatccttctaacattcgtgct 73  Q
    ||||||||||||||||| |||| ||||| |||||||||||    
55419207 gaagctcaactttcctcgaaatgcttctgacattcgtgct 55419246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University