View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2337_high_20 (Length: 236)
Name: NF2337_high_20
Description: NF2337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2337_high_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 236
Target Start/End: Original strand, 3925170 - 3925391
Alignment:
| Q |
15 |
aaaatcaagttaacaattttttcaccgtggatgcaatggagaaatcgaaggataggtaggtagttcataggtgaaaaacttgttgcgtgttggttaattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3925170 |
aaaatcaagttaacaattttttcaccgtggatgcaatggagaaatcaaaggatacgtaggtagttcataggtgaaaaacttgttgcgtgttggttaattt |
3925269 |
T |
 |
| Q |
115 |
tagagtatcaaaccaaaagatcatatgtagtaattgctactaatattttagagaaaattattttgtttatcttaacttaattttgggtaatgattttgtc |
214 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3925270 |
tagattatcaaaccaaaagatcatatgtagtaattgctgctaatattttagagaaaattattttgtttatcttaacttaattttgggtaacgattttgtc |
3925369 |
T |
 |
| Q |
215 |
ttttattttgtacctttacatc |
236 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3925370 |
ttttattttgtacctttacatc |
3925391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University