View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2337_low_17 (Length: 251)
Name: NF2337_low_17
Description: NF2337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2337_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 112 - 238
Target Start/End: Original strand, 34429145 - 34429271
Alignment:
| Q |
112 |
tcttcccgaacaagaatctttccccttcccttccatcccctcacttcctttcaacatccgacaacgaacgtctgacgctccttcaacttcatcttctcac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34429145 |
tcttcccgaacaagaatctttccccttcccttccatcccctcacttcctttcaacatccgacaacgaacgtctgacgctccttcaacttcatcttctcac |
34429244 |
T |
 |
| Q |
212 |
tctatcgaaaccctccctgccggattc |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34429245 |
tctatcgaaaccctccctgccggattc |
34429271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 113 - 234
Target Start/End: Complemental strand, 33738529 - 33738408
Alignment:
| Q |
113 |
cttcccgaacaagaatctttccccttcccttccatcccctcacttcctttcaacatccgacaacgaacgtctgacgctccttcaacttcatcttctcact |
212 |
Q |
| |
|
|||||| ||||| |||||||||| |||| |||||||| || | |||||||| |||||||||||||| |||| | ||||||||||||| |||||||||| |
|
|
| T |
33738529 |
cttcccaaacaacaatctttccctctcccatccatcccatccttccctttcaaaatccgacaacgaacctctggcactccttcaacttcgtcttctcact |
33738430 |
T |
 |
| Q |
213 |
ctatcgaaaccctccctgccgg |
234 |
Q |
| |
|
| ||| ||||||||||| |||| |
|
|
| T |
33738429 |
caatcaaaaccctcccttccgg |
33738408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University